ModCRE DB

Transcription factor

B4E2Y1

cDNA FLJ52879, highly similar to Peroxisome proliferator-activated receptordelta

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 338 aa

17 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)2
MotifPredictionSourceDNA bindingSupportLogoActions
M05584_2.00 NN 70+% CisBP AGAGGTCACGACCTCT 99.4% identity Open · Scan
MA1550.1 NN 70+% JASPAR AGGGGTCAAAGGTCAA 99.4% identity Open · Scan
Nearest Neighbor (70% - 40%)15
MotifPredictionSourceDNA bindingSupportLogoActions
MA1148.1 NN 70-40% JASPAR ATGTAGGTCAAAGGTCAT 69.2% identity Open · Scan
M11139_2.00 NN 70-40% CisBP AAGTAGGTCACCGTGACCTACTT 62.7% identity Open · Scan
MA0065.1 NN 70-40% JASPAR CCAGGGGTCAAAGGTCATCG 62.7% identity Open · Scan
MA0065.2 NN 70-40% JASPAR GTAGGGCAAAGGTCA 61.5% identity Open · Scan
M06417_2.00 NN 70-40% CisBP CAGTCCGAAGGTCACCGC 59.4% identity Open · Scan
MA1540.1 NN 70-40% JASPAR GTCAAGGTCAC 57.1% identity Open · Scan
M02392_2.00 NN 70-40% CisBP GAGGTCAA 56.6% identity Open · Scan
M05590_2.00 NN 70-40% CisBP TTCAAGGTCAC 55.8% identity Open · Scan
M02389_2.00 NN 70-40% CisBP CAGGTCACT 54.5% identity Open · Scan
M03927_2.00 NN 70-40% CisBP GAAACTAGAGCA 54.5% identity Open · Scan
M02413_2.00 NN 70-40% CisBP CGAGATCAA 54.2% identity Open · Scan
M02411_2.00 NN 70-40% CisBP AGGACATC 50.0% identity Open · Scan
M03426_2.00 NN 70-40% CisBP GGGGTCAAAGTCCAAT 50.0% identity Open · Scan
M09616_2.00 NN 70-40% CisBP TTCAAGGTCA 50.0% identity Open · Scan
MA0505.1 NN 70-40% JASPAR AAGTTCAAGGTCAGC 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 338 aa
10-41

Region 10-41 0 PWM

Residues
32 aa
Domains
PF00105 · Double treble clef zinc finger, C4 type
3D models
1 active PDB
Templates
1BY4
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 10-411 model
Actions
Predicted = Low DIMER_B4E2Y1:10:41_1by4_B_1 1by4 10-41 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
8-36PF00105Double treble clef zinc finger, C4 typeoverlaps 10-41
136-317PF00104Ligand-binding domain of nuclear hormone receptorNo overlap with loaded model regions