ModCRE DB

Transcription factor

B4E3U6

cDNA FLJ58239, highly similar to Zinc finger protein 317

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 516 aa

28 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
MA1593.1 NN 70+% JASPAR TAACAGCAGACT 86.3% identity Open · Scan
Nearest Neighbor (70% - 40%)27
MotifPredictionSourceDNA bindingSupportLogoActions
M00939_2.00 NN 70-40% CisBP CCACCTCA 60.7% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 57.5% identity Open · Scan
M01474_2.00 NN 70-40% CisBP CGCCGATCAC 55.1% identity Open · Scan
M07762_2.00 NN 70-40% CisBP GCCGCGCACAGGCTTCTAGCC 54.6% identity Open · Scan
M08985_2.00 NN 70-40% CisBP TGAGGACCTACTGTGTGCC 54.5% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 54.1% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 54.1% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 54.1% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 54.1% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 53.0% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 53.0% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 52.9% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 52.9% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 52.9% identity Open · Scan
M07620_2.00 NN 70-40% CisBP TTGGATCTGTGGATTCATGTCTTTCAT 52.5% identity Open · Scan
M04598_2.00 NN 70-40% CisBP CGCTAACTCTCCACA 52.2% identity Open · Scan
M01456_2.00 NN 70-40% CisBP GTGATCGGCG 52.1% identity Open · Scan
M04611_2.00 NN 70-40% CisBP CTTTCGGACAC 52.0% identity Open · Scan
MA1587.1 NN 70-40% JASPAR CCTCGACCTCCTGA 51.5% identity Open · Scan
M07700_2.00 NN 70-40% CisBP ATGTTGTGAGGAAGCCCA 51.3% identity Open · Scan
M03702_2.00 NN 70-40% CisBP GACCCCCCACGACGC 51.2% identity Open · Scan
M05844_2.00 NN 70-40% CisBP TCACCTGT 50.6% identity Open · Scan
M04387_2.00 NN 70-40% CisBP CGTGCTCCCC 50.4% identity Open · Scan
M08944_2.00 NN 70-40% CisBP TACCATGCTGTTTTGATTAC 50.4% identity Open · Scan
M04650_2.00 NN 70-40% CisBP GCATAACTGCCCCGCTGCC 50.2% identity Open · Scan
M08366_2.00 NN 70-40% CisBP GTTTGCTGCTTACAA 50.2% identity Open · Scan
MA0750.1 NN 70-40% JASPAR GGCGACCACCGA 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 516 aa
143-305

Region 143-305 0 PWM

Residues
163 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5T0U
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 143-3051 model
Actions
Predicted = Low TFS_B4E3U6:143:305_5t0u_A_1 5t0u 143-305 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
143-165PF00096Zinc finger, C2H2 typeoverlaps 143-305
171-193PF00096Zinc finger, C2H2 typeoverlaps 143-305
227-249PF00096Zinc finger, C2H2 typeoverlaps 143-305
255-277PF00096Zinc finger, C2H2 typeoverlaps 143-305
283-305PF00096Zinc finger, C2H2 typeoverlaps 143-305
311-333PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
340-361PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
369-389PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
424-445PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
451-473PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
479-501PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions