Transcription factor

B7Z4K0

cDNA FLJ59245, moderately similar to Eomesodermin homolog

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 590 aa

8 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)2

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
MA0800.1	NN 70+%	JASPAR	AAGGTGTGAAAAT	85.3% identity		Open · Scan
M03563_2.00	NN 70+%	CisBP	AAGGTGTGAAAAT	71.4% identity		Open · Scan

Nearest Neighbor (70% - 40%)6

Motif	Prediction	Source	DNA binding	Support	Actions
MA0690.1	NN 70-40%	JASPAR	AAGGTGTGAA	69.2% identity	Open · Scan
M00734_2.00	NN 70-40%	CisBP	GAGGTGTGAA	66.6% identity	Open · Scan
M00833_2.00	NN 70-40%	CisBP	AGGTGTGA	55.0% identity	Open · Scan
MA0807.1	NN 70-40%	JASPAR	AGGTGTGA	55.0% identity	Open · Scan
M03559_2.00	NN 70-40%	CisBP	AGGTGTGAAATTTCACACCT	52.2% identity	Open · Scan
MA0806.1	NN 70-40%	JASPAR	AGGTGTGA	52.2% identity	Open · Scan

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 590 aa

271-379

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 271-3791 model

				Actions
Predicted = Low	DIMER_B7Z4K0:271:379_4s0h_E_1	4s0h	271-379	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
386-588	PF16176	T-box transcription factor-associated	No overlap with loaded model regions