ModCRE DB

Transcription factor

B7Z5W6

cDNA FLJ52520, highly similar to Eomesodermin homolog

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 570 aa

11 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)2
MotifPredictionSourceDNA bindingSupportLogoActions
M03563_2.00 NN 70+% CisBP AAGGTGTGAAAAT 99.7% identity Open · Scan
MA0800.1 NN 70+% JASPAR AAGGTGTGAAAAT 96.4% identity Open · Scan
Nearest Neighbor (70% - 40%)9
MotifPredictionSourceDNA bindingSupportLogoActions
MA0690.1 NN 70-40% JASPAR AAGGTGTGAA 69.2% identity Open · Scan
M00734_2.00 NN 70-40% CisBP GAGGTGTGAA 61.6% identity Open · Scan
MA0802.1 NN 70-40% JASPAR AGGTGTGAAA 57.5% identity Open · Scan
M00833_2.00 NN 70-40% CisBP AGGTGTGA 53.7% identity Open · Scan
MA0807.1 NN 70-40% JASPAR AGGTGTGA 53.7% identity Open · Scan
M01030_2.00 NN 70-40% CisBP TTGACACCTC 52.9% identity Open · Scan
M02498_2.00 NN 70-40% CisBP AGGTGTCA 52.9% identity Open · Scan
M03559_2.00 NN 70-40% CisBP AGGTGTGAAATTTCACACCT 50.7% identity Open · Scan
MA0806.1 NN 70-40% JASPAR AGGTGTGA 50.7% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 570 aa
134-320

Region 134-320 0 PWM

Residues
187 aa
Domains
PF00907 · T-box
3D models
1 active PDB
Templates
4S0H
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 134-3201 model
Actions
Predicted = Low DIMER_B7Z5W6:134:320_4s0h_E_1 4s0h 134-320 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
135-321PF00907T-boxoverlaps 134-320
347-568PF16176T-box transcription factor-associatedNo overlap with loaded model regions