ModCRE DB

Transcription factor

B7Z6H1

Zinc finger protein ZFAT (Zinc finger protein 406)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 1231 aa

6 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M07842_2.00 NN 70-40% CisBP CTCACCTG 61.7% identity Open · Scan
ModCRE5
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_tr_B7Z6H1_B7Z6H1_HUMAN:894:944_1llm_C_1 ModCRE Homology model TTCGCCGCGCGG Region 894-944 · 1 3D model Open · Scan
TFS_tr_B7Z6H1_B7Z6H1_HUMAN:793:978_8sss_A_1 ModCRE Homology model TCCGGGGGCCCCGGAGGCGCCCC Region 793-978 · 1 3D model Open · Scan
TFS_tr_B7Z6H1_B7Z6H1_HUMAN:793:978_8sst_A_1 ModCRE Homology model CCTCGGGGGGCCGGCCCCGCGGG Region 793-978 · 1 3D model Open · Scan
TFS_tr_B7Z6H1_B7Z6H1_HUMAN:793:979_7w1m_H_1 ModCRE Homology model TGGGGCCCCACTGGGGGGGCACGAGCCTG Region 793-979 · 1 3D model Open · Scan
TFS_tr_B7Z6H1_B7Z6H1_HUMAN:865:979_5t0u_A_1 ModCRE Homology model CCGCAAGGCCCGAGTGTT Region 865-979 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1231 aa
731-979

Region 731-979 5 PWM

Residues
249 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 5T0U, 7W1M, 8SSR, 8SSS, 8SST
Sources
Predicted = Low
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 731-9796 models · 6 summary rows
Actions
Predicted = Low DIMER_tr_B7Z6H1_B7Z6H1_HUMAN:894:944_1llm_C_1 1llm 894-944 View model · PDB
Predicted = Low TFS_tr_B7Z6H1_B7Z6H1_HUMAN:731:974_8ssr_A_1 8ssr 731-974 View model · PDB
Predicted = Low TFS_tr_B7Z6H1_B7Z6H1_HUMAN:793:978_8sss_A_1 8sss 793-978 View model · PDB
Predicted = Low TFS_tr_B7Z6H1_B7Z6H1_HUMAN:793:978_8sst_A_1 8sst 793-978 View model · PDB
Predicted = Low TFS_tr_B7Z6H1_B7Z6H1_HUMAN:793:979_7w1m_H_1 7w1m 793-979 View model · PDB
Predicted = Low TFS_tr_B7Z6H1_B7Z6H1_HUMAN:865:979_5t0u_A_1 5t0u 865-979 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
3 5t0u 731:1006 865 979 P:A · DNA:B,C 41.4% / 56.0% 67 View · PDB TFS_tr_B7Z6H1_B7Z6H1_HUMAN:865:979_5t0u_A_1
1 1llm 731:1006 894,894 944,944 P:C,D · DNA:A,B 35.3% / 52.9% 58,60 View · PDB DIMER_tr_B7Z6H1_B7Z6H1_HUMAN:894:944_1llm_C_1
1 8sst 731:1006 793 978 P:A · DNA:B,C 34.5% / 52.1% 92 View · PDB TFS_tr_B7Z6H1_B7Z6H1_HUMAN:793:978_8sst_A_1
2 8sss 731:1006 793 978 P:A · DNA:B,C 34.5% / 52.1% 92 View · PDB TFS_tr_B7Z6H1_B7Z6H1_HUMAN:793:978_8sss_A_1
4 7w1m 731:1006 793 979 P:H · DNA:F,G 34.4% / 52.3% 57 View · PDB TFS_tr_B7Z6H1_B7Z6H1_HUMAN:793:979_7w1m_H_1
5 8ssr 731:1006 731 974 P:A · DNA:B,C 29.1% / 45.0% 91 View · PDB TFS_tr_B7Z6H1_B7Z6H1_HUMAN:731:974_8ssr_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
259-281PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
287-310PF13909C2H2-type zinc-finger domainNo overlap with loaded model regions
897-919PF00096Zinc finger, C2H2 typeoverlaps 731-979
927-947PF00096Zinc finger, C2H2 typeoverlaps 731-979