ModCRE DB

Transcription factor

B7Z7Y7

cDNA FLJ55813, highly similar to DNA-binding protein RFX2

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 474 aa

10 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)6
MotifPredictionSourceDNA bindingSupportLogoActions
MA0600.1 NN 70+% JASPAR GTTGCCATGGCAACCGCGG 99.7% identity Open · Scan
M09366_2.00 NN 70+% CisBP TCCCGTTGCCATGGCAACCGCC 88.8% identity Open · Scan
M02450_2.00 NN 70+% CisBP CGTTGCTAAG 76.9% identity Open · Scan
MA0509.2 NN 70+% JASPAR CTGTTGCTATGGCA 71.4% identity Open · Scan
M03463_2.00 NN 70+% CisBP GGTTGCCATGGCAACG 70.1% identity Open · Scan
MA0798.1 NN 70+% JASPAR CGTTGCCATGGCAACG 70.1% identity Open · Scan
Nearest Neighbor (70% - 40%)4
MotifPredictionSourceDNA bindingSupportLogoActions
M02451_2.00 NN 70-40% CisBP GTTGCCATGG 65.5% identity Open · Scan
MA0509.1 NN 70-40% JASPAR GTTGCCATGGCAAC 61.8% identity Open · Scan
M02454_2.00 NN 70-40% CisBP CGTTGCTAAG 59.8% identity Open · Scan
M03963_2.00 NN 70-40% CisBP GTTGCTAGGCAAC 54.2% identity Open · Scan
ModCRE0

No generated PWM in this category.

AF3 model assignments
Validated exact-accession AF3 models stored in local staging. Confidence artifacts are indexed but not visualized yet.
1 active AF3 model
TypeModelResidues / fragmentInterfaceConfidence filesActions
AF3 full-length model B7Z7Y7_model.cif Full sequence PASS_NONEMPTY_PROTEIN_DNA_INTERFACE 3 indexed View model · mmCIF

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomain
2-24PF02257RFX DNA-binding domain
122-410PF25340RFX BCD domain