ModCRE DB

Transcription factor

B7Z8F5

cDNA FLJ53376, highly similar to DNA-binding protein RFX2

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 510 aa

9 Generated PWM

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)2
MotifPredictionSourceDNA bindingSupportLogoActions
M02450_2.00 NN 70+% CisBP CGTTGCTAAG 76.3% identity Open · Scan
MA0600.1 NN 70+% JASPAR GTTGCCATGGCAACCGCGG 75.0% identity Open · Scan
Nearest Neighbor (70% - 40%)7
MotifPredictionSourceDNA bindingSupportLogoActions
M03463_2.00 NN 70-40% CisBP GGTTGCCATGGCAACG 69.1% identity Open · Scan
MA0798.1 NN 70-40% JASPAR CGTTGCCATGGCAACG 69.1% identity Open · Scan
M09366_2.00 NN 70-40% CisBP TCCCGTTGCCATGGCAACCGCC 68.3% identity Open · Scan
M02451_2.00 NN 70-40% CisBP GTTGCCATGG 64.3% identity Open · Scan
MA0509.1 NN 70-40% JASPAR GTTGCCATGGCAAC 60.6% identity Open · Scan
M02454_2.00 NN 70-40% CisBP CGTTGCTAAG 58.7% identity Open · Scan
M03963_2.00 NN 70-40% CisBP GTTGCTAGGCAAC 52.8% identity Open · Scan
ModCRE0

No generated PWM in this category.

PWM available; no validated DNA-bound structure

Exact accession contains only an incomplete portion of the expected DNA-binding domain.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomain
1-51PF04589RFX1 transcription activation region
158-446PF25340RFX BCD domain