ModCRE DB

Transcription factor

B7Z8Q3

Nuclear receptor subfamily 1 group I member 3 (Constitutive androstane receptor)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 297 aa

21 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
MA1534.1 NN 70+% JASPAR ATGAACTTT 97.8% identity Open · Scan
Nearest Neighbor (70% - 40%)20
MotifPredictionSourceDNA bindingSupportLogoActions
M03382_2.00 NN 70-40% CisBP GGGAACACAATGTTCCC 66.6% identity Open · Scan
MA0727.1 NN 70-40% JASPAR GGGAACACAATGTTCCC 66.6% identity Open · Scan
M03923_2.00 NN 70-40% CisBP AGAACACTGTGTACC 62.5% identity Open · Scan
M05886_2.00 NN 70-40% CisBP AGTACATTTTGTTCT 58.3% identity Open · Scan
M07987_2.00 NN 70-40% CisBP GCCCAGAACATTCTGTTCCCT 58.3% identity Open · Scan
MA0113.1 NN 70-40% JASPAR GGGAACATTATGTCCTAA 58.3% identity Open · Scan
MA0164.1 NN 70-40% JASPAR CAAGCTT 56.2% identity Open · Scan
M00371_2.00 NN 70-40% CisBP ACTTAATATATAC 55.1% identity Open · Scan
M00814_2.00 NN 70-40% CisBP AAAGTCAAAT 54.8% identity Open · Scan
M02409_2.00 NN 70-40% CisBP GAGATCAA 54.8% identity Open · Scan
M06432_2.00 NN 70-40% CisBP AAAAATCAAAGGT 54.8% identity Open · Scan
MA0676.1 NN 70-40% JASPAR AAAAGTCAA 54.8% identity Open · Scan
MA0007.1 NN 70-40% JASPAR ATAAGAACACCCTGTACCCGCC 54.1% identity Open · Scan
MA0007.2 NN 70-40% JASPAR AAGAACAGAATGTTC 54.1% identity Open · Scan
MA0007.3 NN 70-40% JASPAR GGGAACACGGTGTACCC 54.1% identity Open · Scan
MA1540.1 NN 70-40% JASPAR GTCAAGGTCAC 52.3% identity Open · Scan
M06431_2.00 NN 70-40% CisBP AAAAGTCAAA 51.6% identity Open · Scan
M00690_2.00 NN 70-40% CisBP AAAGATCAAA 50.0% identity Open · Scan
M03940_2.00 NN 70-40% CisBP TAAGTGCACGTGTACCCA 50.0% identity Open · Scan
M06417_2.00 NN 70-40% CisBP CAGTCCGAAGGTCACCGC 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 297 aa
7-47

Region 7-47 0 PWM

Residues
41 aa
Domains
PF00105 · Double treble clef zinc finger, C4 type
3D models
1 active PDB
Templates
1LAT
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 7-471 model
Actions
Predicted = Low DIMER_B7Z8Q3:7:47_1lat_A_1 1lat 7-47 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
7-49PF00105Double treble clef zinc finger, C4 typeoverlaps 7-47
130-279PF00104Ligand-binding domain of nuclear hormone receptorNo overlap with loaded model regions