ModCRE DB

Transcription factor

B7ZKX2

Zinc finger protein 445

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 1019 aa

10 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M07674_2.00 NN 70+% CisBP AAATCCTTGACAATCAAGGGTTCCCTCAC 98.8% identity Open · Scan
Nearest Neighbor (70% - 40%)9
MotifPredictionSourceDNA bindingSupportLogoActions
M04611_2.00 NN 70-40% CisBP CTTTCGGACAC 65.9% identity Open · Scan
M04653_2.00 NN 70-40% CisBP GGTACGGTTGTCCATGTTGCAA 56.8% identity Open · Scan
M04483_2.00 NN 70-40% CisBP ATGCACACACTGAAAAA 56.5% identity Open · Scan
M00769_2.00 NN 70-40% CisBP ACTCCCCC 54.3% identity Open · Scan
M00641_2.00 NN 70-40% CisBP ATTGACCACT 52.8% identity Open · Scan
M04530_2.00 NN 70-40% CisBP CCGTCCCCCTCCCCCC 52.7% identity Open · Scan
M08908_2.00 NN 70-40% CisBP GCTGCTGCTTCTGCTG 51.1% identity Open · Scan
M01456_2.00 NN 70-40% CisBP GTGATCGGCG 50.9% identity Open · Scan
M01474_2.00 NN 70-40% CisBP CGCCGATCAC 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1019 aa
47-89

Region 47-89 0 PWM

Residues
43 aa
Domains
PF02023 · SCAN domain
3D models
1 active PDB
Templates
4UUV
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 47-891 model
Actions
Predicted = Low DIMER_B7ZKX2:47:89_4uuv_V_1 4uuv 47-89 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
51-138PF02023SCAN domainoverlaps 47-89
222-261PF01352KRAB boxNo overlap with loaded model regions
473-495PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
529-551PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
613-635PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
669-691PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
697-719PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
750-772PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
778-800PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
830-850PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
856-878PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
884-906PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
966-988PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
994-1016PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions