Region 638-825 3 PWM
- Residues
- 188 aa
- Domains
- PF00096 · Zinc finger, C2H2 type
- 3D models
- 6 active PDBs · 6 summary rows
- Templates
- 1LLM, 8SSQ, 8SSR, 8SSS, 8SST, 8SSU
- Sources
- Predicted = Low
Transcription factor
B9EGE7 - ZNF507
Zinc finger protein 507
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 957 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known0
No generated PWM in this category.
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)0
No generated PWM in this category.
ModCRE3
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| TFS_tr_B9EGE7_B9EGE7_HUMAN:638:825_8ssu_A_1 | ModCRE | Homology model | GACCTCGGCAGGGATTTGG | Region 638-825 · 1 3D model | Open · Scan | |
| TFS_tr_B9EGE7_B9EGE7_HUMAN:641:786_8sss_A_1 | ModCRE | Homology model | CCTCCTCGCTACTGCCATTCA | Region 641-786 · 1 3D model | Open · Scan | |
| TFS_tr_B9EGE7_B9EGE7_HUMAN:641:786_8sst_A_1 | ModCRE | Homology model | CCCCCCCCCCACCCCCATTTA | Region 641-786 · 1 3D model | Open · Scan |
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
957 aa
638-825
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models
6 summary rows
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 638-8256 models · 6 summary rows
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | DIMER_tr_B9EGE7_B9EGE7_HUMAN:639:687_1llm_C_1 | 1llm | 639-687 | View model · PDB |
| Predicted = Low | TFS_tr_B9EGE7_B9EGE7_HUMAN:638:825_8ssq_A_1 | 8ssq | 638-825 | View model · PDB |
| Predicted = Low | TFS_tr_B9EGE7_B9EGE7_HUMAN:638:825_8ssr_A_1 | 8ssr | 638-825 | View model · PDB |
| Predicted = Low | TFS_tr_B9EGE7_B9EGE7_HUMAN:638:825_8ssu_A_1 | 8ssu | 638-825 | View model · PDB |
| Predicted = Low | TFS_tr_B9EGE7_B9EGE7_HUMAN:641:786_8sss_A_1 | 8sss | 641-786 | View model · PDB |
| Predicted = Low | TFS_tr_B9EGE7_B9EGE7_HUMAN:641:786_8sst_A_1 | 8sst | 641-786 | View model · PDB |
Model-summary evidence imported for this region.
| Rank | Template | Domain | N-tails | C-tails | Chains | Identity / similarity | Coverage | Model file |
|---|---|---|---|---|---|---|---|---|
| 1 | 1llm | 629:826 | 639,639 | 687,687 | P:C,D · DNA:A,B | 26.5% / 49.0% | 56,57 | View · PDB DIMER_tr_B9EGE7_B9EGE7_HUMAN:639:687_1llm_C_1 |
| 1 | 8sst | 629:826 | 641 | 786 | P:A · DNA:B,C | 22.6% / 45.9% | 72 | View · PDB TFS_tr_B9EGE7_B9EGE7_HUMAN:641:786_8sst_A_1 |
| 2 | 8sss | 629:826 | 641 | 786 | P:A · DNA:B,C | 22.6% / 45.9% | 72 | View · PDB TFS_tr_B9EGE7_B9EGE7_HUMAN:641:786_8sss_A_1 |
| 3 | 8ssu | 629:826 | 638 | 825 | P:A · DNA:B,C | 21.8% / 43.6% | 78 | View · PDB TFS_tr_B9EGE7_B9EGE7_HUMAN:638:825_8ssu_A_1 |
| 4 | 8ssr | 629:826 | 638 | 825 | P:A · DNA:B,C | 21.8% / 43.6% | 70 | View · PDB TFS_tr_B9EGE7_B9EGE7_HUMAN:638:825_8ssr_A_1 |
| 5 | 8ssq | 629:826 | 638 | 825 | P:A · DNA:B,C | 21.8% / 43.6% | 70 | View · PDB TFS_tr_B9EGE7_B9EGE7_HUMAN:638:825_8ssq_A_1 |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 697-720 | PF00096 | Zinc finger, C2H2 type | overlaps 638-825 |