ModCRE DB

Transcription factor

C0JKD5 - AR

Androgen receptor splice variant 4b

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 647 aa

16 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)8
MotifPredictionSourceDNA bindingSupportLogoActions
M09609_2.00 NN 70+% CisBP CCAGGAACAG 98.4% identity Open · Scan
MA0007.2 NN 70+% JASPAR AAGAACAGAATGTTC 98.2% identity Open · Scan
M03923_2.00 NN 70+% CisBP AGAACACTGTGTACC 78.8% identity Open · Scan
MA0007.1 NN 70+% JASPAR ATAAGAACACCCTGTACCCGCC 78.6% identity Open · Scan
MA0007.3 NN 70+% JASPAR GGGAACACGGTGTACCC 78.1% identity Open · Scan
M05886_2.00 NN 70+% CisBP AGTACATTTTGTTCT 76.0% identity Open · Scan
M07987_2.00 NN 70+% CisBP GCCCAGAACATTCTGTTCCCT 76.0% identity Open · Scan
MA0113.1 NN 70+% JASPAR GGGAACATTATGTCCTAA 76.0% identity Open · Scan
Nearest Neighbor (70% - 40%)8
MotifPredictionSourceDNA bindingSupportLogoActions
MA0727.1 NN 70-40% JASPAR GGGAACACAATGTTCCC 64.5% identity Open · Scan
M03382_2.00 NN 70-40% CisBP GGGAACACAATGTTCCC 62.8% identity Open · Scan
MA0258.1 NN 70-40% JASPAR CAAGGTCACGGTGACCTG 56.7% identity Open · Scan
M05669_2.00 NN 70-40% CisBP GAGGTCAT 51.5% identity Open · Scan
MA0504.1 NN 70-40% JASPAR AGGGGTCAGAGGTCA 51.5% identity Open · Scan
M08226_2.00 NN 70-40% CisBP CAAGGTCA 50.7% identity Open · Scan
MA1540.1 NN 70-40% JASPAR GTCAAGGTCAC 50.7% identity Open · Scan
M06417_2.00 NN 70-40% CisBP CAGTCCGAAGGTCACCGC 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 647 aa
556-625

Region 556-625 0 PWM

Residues
70 aa
Domains
PF00105 · Double treble clef zinc finger, C4 type
3D models
1 active PDB
Templates
1R4I
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 556-6251 model
Actions
Predicted = Low DIMER_C0JKD5:556:625_1r4i_A_1 1r4i 556-625 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
6-453PF02166Androgen receptorNo overlap with loaded model regions
558-625PF00105Double treble clef zinc finger, C4 typeoverlaps 556-625