ModCRE DB

Transcription factor

C0KTE2 - PAX5

B cell specific activator protein variant insert 6/7

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 218 aa

13 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)3
MotifPredictionSourceDNA bindingSupportLogoActions
MA0014.2 NN 70+% JASPAR GAGGGCAGCCAAGCGTGAC 91.2% identity Open · Scan
MA0014.1 NN 70+% JASPAR AGAGCACTGAAGCGTAACCG 90.3% identity Open · Scan
M09622_2.00 NN 70+% CisBP GCAGCCAAGCGTGACC 77.9% identity Open · Scan
Nearest Neighbor (70% - 40%)10
MotifPredictionSourceDNA bindingSupportLogoActions
M03294_2.00 NN 70-40% CisBP CGTCACGCTTGACTGCTC 59.6% identity Open · Scan
MA0067.1 NN 70-40% JASPAR AGTCACGC 58.1% identity Open · Scan
M00354_2.00 NN 70-40% CisBP CCGATTA 57.1% identity Open · Scan
MA0780.1 NN 70-40% JASPAR TAATCGATTA 57.1% identity Open · Scan
M05419_2.00 NN 70-40% CisBP CGATTAGTCACGGTT 54.2% identity Open · Scan
MA0680.1 NN 70-40% JASPAR TAATCGATTA 54.2% identity Open · Scan
MA0075.1 NN 70-40% JASPAR AATTA 53.8% identity Open · Scan
MA0713.1 NN 70-40% JASPAR TAATTTAATTA 53.8% identity Open · Scan
M02425_2.00 NN 70-40% CisBP CAGTCAAGCG 50.0% identity Open · Scan
MA1481.1 NN 70-40% JASPAR CTAATTAC 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 218 aa
37-62

Region 37-62 0 PWM

Residues
26 aa
Domains
No overlapping PFAM annotation recorded
3D models
1 active PDB
Templates
1FJL
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 37-621 model
Actions
Predicted = Low DIMER_C0KTE2:37:62_1fjl_B_1 1fjl 37-62 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
110-217PF12403Paired-box protein 2 C terminalNo overlap with loaded model regions