Transcription factor

C0KTE3 - PAX5

B cell specific activator protein variant delta 8

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 165 aa

10 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)3

Motif	Prediction	Source	DNA binding	Support	Actions
MA0014.2	NN 70+%	JASPAR	GAGGGCAGCCAAGCGTGAC	82.9% identity	Open · Scan
M09622_2.00	NN 70+%	CisBP	GCAGCCAAGCGTGACC	82.3% identity	Open · Scan
MA0014.1	NN 70+%	JASPAR	AGAGCACTGAAGCGTAACCG	81.9% identity	Open · Scan

Nearest Neighbor (70% - 40%)7

Motif	Prediction	Source	DNA binding	Support	Actions
MA0075.1	NN 70-40%	JASPAR	AATTA	53.8% identity	Open · Scan
M02690_2.00	NN 70-40%	CisBP	AGTCACGC	52.9% identity	Open · Scan
M03294_2.00	NN 70-40%	CisBP	CGTCACGCTTGACTGCTC	50.7% identity	Open · Scan
M00354_2.00	NN 70-40%	CisBP	CCGATTA	50.0% identity	Open · Scan
M02425_2.00	NN 70-40%	CisBP	CAGTCAAGCG	50.0% identity	Open · Scan
MA0780.1	NN 70-40%	JASPAR	TAATCGATTA	50.0% identity	Open · Scan
MA1481.1	NN 70-40%	JASPAR	CTAATTAC	50.0% identity	Open · Scan

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 165 aa

37-71

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 37-711 model

				Actions
Predicted = Low	DIMER_C0KTE3:37:71_1fjl_B_1	1fjl	37-71	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
108-164	PF12403	Paired-box protein 2 C terminal	No overlap with loaded model regions