ModCRE DB

Transcription factor

C0LLI8 - ESR1

Estrogen receptor alpha delta 6,7 isoform

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 220 aa

19 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)13
MotifPredictionSourceDNA bindingSupportLogoActions
M02418_2.00 NN 70-40% CisBP CGGAAGCAAA 68.7% identity Open · Scan
MA0112.1 NN 70-40% JASPAR CCAGGTCACCGTGACCCC 67.4% identity Open · Scan
M03927_2.00 NN 70-40% CisBP GAAACTAGAGCA 62.9% identity Open · Scan
M09309_2.00 NN 70-40% CisBP AGGTCAGGGTGACCT 62.0% identity Open · Scan
M02389_2.00 NN 70-40% CisBP CAGGTCACT 58.6% identity Open · Scan
M02408_2.00 NN 70-40% CisBP TGAGGTCAATTT 57.6% identity Open · Scan
M03930_2.00 NN 70-40% CisBP AACTAGAGCAC 55.1% identity Open · Scan
M05660_2.00 NN 70-40% CisBP GATGTGGGTCAGTGGGTCAG 53.1% identity Open · Scan
MA1532.1 NN 70-40% JASPAR GGGTTAGTGGGTCAT 53.1% identity Open · Scan
M00685_2.00 NN 70-40% CisBP AAAGTGCAAA 51.8% identity Open · Scan
M00690_2.00 NN 70-40% CisBP AAAGATCAAA 50.0% identity Open · Scan
M02414_2.00 NN 70-40% CisBP TAGTCACAAA 50.0% identity Open · Scan
MA1531.1 NN 70-40% JASPAR GGGTCAGTAGGTCAG 50.0% identity Open · Scan
ModCRE6
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_tr_C0LLI8_C0LLI8_HUMAN:1:17_4oln_B_1 ModCRE Homology model CTTGAAAAATTTTGACTAT Region 1-17 · 1 3D model Open · Scan
DIMER_tr_C0LLI8_C0LLI8_HUMAN:1:18_4aa6_B_1 ModCRE Homology model AGGGTCGCGAGGACCCT Region 1-18 · 1 3D model Open · Scan
DIMER_tr_C0LLI8_C0LLI8_HUMAN:1:19_1hcq_B_1 ModCRE Homology model TAGTAAAACGGCGTCTT Region 1-19 · 1 3D model Open · Scan
DIMER_tr_C0LLI8_C0LLI8_HUMAN:1:20_1r4i_B_1 ModCRE Homology model AAAGGTAACGGTTTACTT Region 1-20 · 1 3D model Open · Scan
TFS_tr_C0LLI8_C0LLI8_HUMAN:1:18_4aa6_A_1 ModCRE Homology model AAGGTCACATGGACCCT Region 1-18 · 1 3D model Open · Scan
TFS_tr_C0LLI8_C0LLI8_HUMAN:1:19_1hcq_B_1 ModCRE Homology model AAGACCCCGATGACCTT Region 1-19 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 220 aa
1-20

Region 1-20 6 PWM

Residues
20 aa
Domains
PF00105 · Double treble clef zinc finger, C4 type
3D models
6 active PDBs
Templates
1HCQ, 1R4I, 4AA6, 4OLN
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models
Region 1-206 models
Actions
Predicted = Low DIMER_tr_C0LLI8_C0LLI8_HUMAN:1:17_4oln_B_1 4oln 1-17 View model · PDB
Predicted = Low DIMER_tr_C0LLI8_C0LLI8_HUMAN:1:18_4aa6_B_1 4aa6 1-18 View model · PDB
Predicted = Low DIMER_tr_C0LLI8_C0LLI8_HUMAN:1:19_1hcq_B_1 1hcq 1-19 View model · PDB
Predicted = Low DIMER_tr_C0LLI8_C0LLI8_HUMAN:1:20_1r4i_B_1 1r4i 1-20 View model · PDB
Predicted = Low TFS_tr_C0LLI8_C0LLI8_HUMAN:1:18_4aa6_A_1 4aa6 1-18 View model · PDB
Predicted = Low TFS_tr_C0LLI8_C0LLI8_HUMAN:1:19_1hcq_B_1 1hcq 1-19 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
1-19PF00105Double treble clef zinc finger, C4 typeoverlaps 1-20
104-183PF00104Ligand-binding domain of nuclear hormone receptorNo overlap with loaded model regions