ModCRE DB

Transcription factor

C3UMV3

EWSR1/NFATC2 fusion protein

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 859 aa

8 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)3
MotifPredictionSourceDNA bindingSupportLogoActions
MA0152.1 NN 70+% JASPAR TTTTCCA 99.8% identity Open · Scan
MA0149.1 NN 70+% JASPAR GGAAGGAAGGAAGGAAGG 96.6% identity Open · Scan
M03449_2.00 NN 70+% CisBP AGGGAAAATAATTTTCCATT 72.6% identity Open · Scan
Nearest Neighbor (70% - 40%)5
MotifPredictionSourceDNA bindingSupportLogoActions
M05693_2.00 NN 70-40% CisBP ATTTTCCATT 61.2% identity Open · Scan
MA0625.1 NN 70-40% JASPAR ATTTTCCATT 61.2% identity Open · Scan
MA1525.1 NN 70-40% JASPAR AATGGAAAAT 60.2% identity Open · Scan
M05703_2.00 NN 70-40% CisBP ATTTTCCGTT 56.6% identity Open · Scan
MA0624.1 NN 70-40% JASPAR ATTTTCCATT 54.6% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 859 aa
330-615

Region 330-615 0 PWM

Residues
286 aa
Domains
PF00554 · Rel homology DNA-binding domain PF16179 · Rel homology dimerisation domain
3D models
1 active PDB
Templates
2O93
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 330-6151 model
Actions
Predicted = Low DIMER_C3UMV3:330:615_2o93_L_1 2o93 330-615 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
348-508PF00554Rel homology DNA-binding domainoverlaps 330-615
518-616PF16179Rel homology dimerisation domainoverlaps 330-615