ModCRE DB

Transcription factor

C9JCJ0 - ZNF668

Zinc finger protein 668

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 163 aa

6 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)1
MotifPredictionSourceDNA bindingSupportLogoActions
MA0056.1 NN 70-40% JASPAR TGGGGA 50.0% identity Open · Scan
ModCRE5
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_C9JCJ0_C9JCJ0_HUMAN:22:162_2i13_A_1 ModCRE Homology model GTGCCTCCAACACCGGACCGG Region 22-162 · 1 3D model Open · Scan
TFS_tr_C9JCJ0_C9JCJ0_HUMAN:82:163_5ei9_E_1 ModCRE Homology model GCAACCCCGGGGGGGGG Region 82-163 · 1 3D model Open · Scan
TFS_tr_C9JCJ0_C9JCJ0_HUMAN:84:163_5v3j_E_1 ModCRE Homology model GACGGCACATC Region 84-163 · 1 3D model Open · Scan
TFS_tr_C9JCJ0_C9JCJ0_HUMAN:84:163_5v3m_C_1 ModCRE Homology model CAACGGATCATCC Region 84-163 · 1 3D model Open · Scan
TFS_tr_C9JCJ0_C9JCJ0_HUMAN:84:163_5wjq_D_1 ModCRE Homology model CATCGATTCATCC Region 84-163 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 163 aa
22-163

Region 22-163 5 PWM

Residues
142 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 2I13, 5EI9, 5V3J, 5V3M, 5WJQ
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 22-1636 models · 6 summary rows
Actions
Predicted = Low DIMER_tr_C9JCJ0_C9JCJ0_HUMAN:82:121_1llm_D_1 1llm 82-121 View model · PDB
Predicted = Low TFS_tr_C9JCJ0_C9JCJ0_HUMAN:22:162_2i13_A_1 2i13 22-162 View model · PDB
Predicted = Low TFS_tr_C9JCJ0_C9JCJ0_HUMAN:82:163_5ei9_E_1 5ei9 82-163 View model · PDB
Predicted = Low TFS_tr_C9JCJ0_C9JCJ0_HUMAN:84:163_5v3j_E_1 5v3j 84-163 View model · PDB
Predicted = Low TFS_tr_C9JCJ0_C9JCJ0_HUMAN:84:163_5v3m_C_1 5v3m 84-163 View model · PDB
Predicted = Low TFS_tr_C9JCJ0_C9JCJ0_HUMAN:84:163_5wjq_D_1 5wjq 84-163 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 1llm 22:163 82,82 121,121 P:C,D · DNA:A,B 45.0% / 67.5% 45,47 View · PDB DIMER_tr_C9JCJ0_C9JCJ0_HUMAN:82:121_1llm_D_1
2 5wjq 22:163 84 163 P:D · DNA:A,B 43.8% / 52.5% 28 View · PDB TFS_tr_C9JCJ0_C9JCJ0_HUMAN:84:163_5wjq_D_1
3 5v3m 22:163 84 163 P:C · DNA:A,B 43.8% / 52.5% 28 View · PDB TFS_tr_C9JCJ0_C9JCJ0_HUMAN:84:163_5v3m_C_1
4 5v3j 22:163 84 163 P:E · DNA:A,B 43.8% / 52.5% 28 View · PDB TFS_tr_C9JCJ0_C9JCJ0_HUMAN:84:163_5v3j_E_1
5 5ei9 22:163 82 163 P:E · DNA:A,B 41.5% / 53.7% 73 View · PDB TFS_tr_C9JCJ0_C9JCJ0_HUMAN:82:163_5ei9_E_1
1 2i13 22:163 22 162 P:A · DNA:C,D 37.5% / 49.3% 87 View · PDB TFS_tr_C9JCJ0_C9JCJ0_HUMAN:22:162_2i13_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
84-106PF00096Zinc finger, C2H2 typeoverlaps 22-163
112-134PF00096Zinc finger, C2H2 typeoverlaps 22-163
140-162PF00096Zinc finger, C2H2 typeoverlaps 22-163