Region 12-42 3 PWM
- Residues
- 31 aa
- Domains
- No overlapping PFAM annotation recorded
- 3D models
- 4 active PDBs · 4 summary rows
- Templates
- 4LDX, 6YCQ
- Sources
- Predicted = Low
Transcription factor
C9JI46 - LCORL
Ligand dependent nuclear receptor corepressor like
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 518 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known0
No generated PWM in this category.
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)4
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M06443_2.00 | NN 70-40% | CisBP | ACACCCGAAAAT | 62.0% identity | Open · Scan | |
| M02434_2.00 | NN 70-40% | CisBP | CCCAAAAT | 58.9% identity | Open · Scan | |
| M00707_2.00 | NN 70-40% | CisBP | GGGGGGCCAA | 56.6% identity | Open · Scan | |
| M02439_2.00 | NN 70-40% | CisBP | GCCGAAATTT | 50.0% identity | Open · Scan |
ModCRE3
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| DIMER_tr_C9JI46_C9JI46_HUMAN:12:42_4ldx_B_1 | ModCRE | Homology model | GGGACCAGCCAGGTTGGTCCC | Region 12-42 · 1 3D model | Open · Scan | |
| TFS_tr_C9JI46_C9JI46_HUMAN:12:42_4ldx_B_1 | ModCRE | Homology model | GGGACCAGACAGGATGTTCCC | Region 12-42 · 1 3D model | Open · Scan | |
| TFS_tr_C9JI46_C9JI46_HUMAN:12:42_6ycq_B_1 | ModCRE | Homology model | GGGACCAAGCAGCTTGGGGCC | Region 12-42 · 1 3D model | Open · Scan |
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
518 aa
12-42
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
4 active PDB models
4 summary rows
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 12-424 models · 4 summary rows
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | DIMER_tr_C9JI46_C9JI46_HUMAN:12:42_4ldx_B_1 | 4ldx | 12-42 | View model · PDB |
| Predicted = Low | DIMER_tr_C9JI46_C9JI46_HUMAN:12:42_6ycq_B_1 | 6ycq | 12-42 | View model · PDB |
| Predicted = Low | TFS_tr_C9JI46_C9JI46_HUMAN:12:42_4ldx_B_1 | 4ldx | 12-42 | View model · PDB |
| Predicted = Low | TFS_tr_C9JI46_C9JI46_HUMAN:12:42_6ycq_B_1 | 6ycq | 12-42 | View model · PDB |
Model-summary evidence imported for this region.
| Rank | Template | Domain | N-tails | C-tails | Chains | Identity / similarity | Coverage | Model file |
|---|---|---|---|---|---|---|---|---|
| 1 | 4ldx | 12:42 | 12,12 | 42,42 | P:A,B · DNA:C,D | 38.7% / 54.8% | 9,9 | View · PDB TFS_tr_C9JI46_C9JI46_HUMAN:12:42_4ldx_B_1 |
| 1 | 4ldx | 12:42 | 12,12 | 42,42 | P:A,B · DNA:C,D | 38.7% / 54.8% | 9,9 | View · PDB DIMER_tr_C9JI46_C9JI46_HUMAN:12:42_4ldx_B_1 |
| 2 | 6ycq | 12:42 | 12,12 | 42,42 | P:A,B · DNA:C,D | 38.7% / 54.8% | 8,9 | View · PDB TFS_tr_C9JI46_C9JI46_HUMAN:12:42_6ycq_B_1 |
| 2 | 6ycq | 12:42 | 12,12 | 42,42 | P:A,B · DNA:C,D | 38.7% / 54.8% | 8,9 | View · PDB DIMER_tr_C9JI46_C9JI46_HUMAN:12:42_6ycq_B_1 |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 196-227 | PF05225 | helix-turn-helix, Psq domain | No overlap with loaded model regions |
| 442-486 | PF05225 | helix-turn-helix, Psq domain | No overlap with loaded model regions |