Transcription factor

D2E453 - PRDM9

PRDM9

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 384 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M07610_2.00	Known	CisBP	CCTTCTTCCTCCCCCCTGCCCACC	Direct PWM		Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 384 aa

184-342

Residues: 159 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models: 1 active PDB
Templates: 5T0U
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 184-3421 model

				Actions
Predicted = Low	TFS_D2E453:184:342_5t0u_A_1	5t0u	184-342	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
42-64	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
70-92	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
98-120	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
126-148	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
154-176	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
182-204	PF00096	Zinc finger, C2H2 type	overlaps 184-342
210-232	PF00096	Zinc finger, C2H2 type	overlaps 184-342
238-260	PF00096	Zinc finger, C2H2 type	overlaps 184-342
266-288	PF00096	Zinc finger, C2H2 type	overlaps 184-342
294-316	PF00096	Zinc finger, C2H2 type	overlaps 184-342
322-344	PF00096	Zinc finger, C2H2 type	overlaps 184-342
350-372	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions