Region 107-187 0 PWM
- Residues
- 81 aa
- Domains
- PF00105 · Double treble clef zinc finger, C4 type
- 3D models
- 1 active PDB
- Templates
- 1A6Y
- Sources
- Structure model
Transcription factor
Peroxisome proliferator-activated receptor gamma (PPAR-gamma) (Nuclear receptor subfamily 1 group C member 3)
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 477 aa
Only entries with a generated matrix are shown here.
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M11139_2.00 | Known | CisBP | AAGTAGGTCACCGTGACCTACTT | Direct PWM | Open · Scan |
No generated PWM in this category.
No generated PWM in this category.
No generated PWM in this category.
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | DIMER_D2KUA6:107:187_1a6y_B_1 | 1a6y | 107-187 | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 3-80 | PF12577 | PPAR gamma N-terminal region | No overlap with loaded model regions |
| 110-176 | PF00105 | Double treble clef zinc finger, C4 type | overlaps 107-187 |
| 291-457 | PF00104 | Ligand-binding domain of nuclear hormone receptor | No overlap with loaded model regions |