ModCRE DB

Transcription factor

D6RAX4 - RFX8

DNA-binding protein RFX8 (Regulatory factor X 8)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 80 aa

15 Generated PWM 2 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)13
MotifPredictionSourceDNA bindingSupportLogoActions
M05727_2.00 NN 70-40% CisBP GGTTGCTAGGCGTTGCTAG 56.2% identity Open · Scan
MA0510.1 NN 70-40% JASPAR CTCCCTGGCAACAGC 56.2% identity Open · Scan
M02454_2.00 NN 70-40% CisBP CGTTGCTAAG 54.3% identity Open · Scan
MA0509.2 NN 70-40% JASPAR CTGTTGCTATGGCA 53.1% identity Open · Scan
M00709_2.00 NN 70-40% CisBP GGTTGCTATG 52.6% identity Open · Scan
MA0509.1 NN 70-40% JASPAR GTTGCCATGGCAAC 52.6% identity Open · Scan
M05721_2.00 NN 70-40% CisBP CGTTGCCATGGCAACG 51.6% identity Open · Scan
MA0799.1 NN 70-40% JASPAR CGTTGCCATGGCAACG 51.6% identity Open · Scan
M02450_2.00 NN 70-40% CisBP CGTTGCTAAG 50.8% identity Open · Scan
M02451_2.00 NN 70-40% CisBP GTTGCCATGG 50.8% identity Open · Scan
M09366_2.00 NN 70-40% CisBP TCCCGTTGCCATGGCAACCGCC 50.8% identity Open · Scan
MA0600.1 NN 70-40% JASPAR GTTGCCATGGCAACCGCGG 50.8% identity Open · Scan
M03963_2.00 NN 70-40% CisBP GTTGCTAGGCAAC 50.0% identity Open · Scan
ModCRE2
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_D6RAX4_D6RAX4_HUMAN:14:31_7et6_A_1 ModCRE Homology model TACTTTTTCGCGC Region 14-31 · 1 3D model Open · Scan
TFS_tr_D6RAX4_D6RAX4_HUMAN:14:31_7et6_D_1 ModCRE Homology model CCCCGGG Region 14-31 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 80 aa
14-31

Region 14-31 2 PWM

Residues
18 aa
Domains
PF02257 · RFX DNA-binding domain
3D models
2 active PDBs · 2 summary rows
Templates
7ET6
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
2 active PDB models 2 summary rows
Region 14-312 models · 2 summary rows
Actions
Predicted = Low TFS_tr_D6RAX4_D6RAX4_HUMAN:14:31_7et6_A_1 7et6 14-31 View model · PDB
Predicted = Low TFS_tr_D6RAX4_D6RAX4_HUMAN:14:31_7et6_D_1 7et6 14-31 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 7et6 14:31 14 31 P:D · DNA:E,F 55.6% / 61.1% 16 View · PDB TFS_tr_D6RAX4_D6RAX4_HUMAN:14:31_7et6_D_1
2 7et6 14:31 14 31 P:A · DNA:E,F 55.6% / 61.1% 17 View · PDB TFS_tr_D6RAX4_D6RAX4_HUMAN:14:31_7et6_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
1-54PF02257RFX DNA-binding domainoverlaps 14-31