ModCRE DB

Transcription factor

E5RG51 - HSF4

Heat shock transcription factor 4

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 194 aa

9 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
MA0771.1 NN 70+% JASPAR TTCTAGAACGTTC 98.6% identity Open · Scan
Nearest Neighbor (70% - 40%)8
MotifPredictionSourceDNA bindingSupportLogoActions
M03330_2.00 NN 70-40% CisBP GAACGTTCTAGAA 69.4% identity Open · Scan
M01257_2.00 NN 70-40% CisBP AATCTTCCAT 68.4% identity Open · Scan
MA0486.1 NN 70-40% JASPAR CTTCTAGAAGGTTCT 67.9% identity Open · Scan
M02248_2.00 NN 70-40% CisBP GAATGTTCTATAT 57.4% identity Open · Scan
M05506_2.00 NN 70-40% CisBP GGAACGTTCTAGAAC 56.0% identity Open · Scan
MA0770.1 NN 70-40% JASPAR TTCTAGAACGTTC 56.0% identity Open · Scan
M06388_2.00 NN 70-40% CisBP TCGAAACTTCTAGA 52.3% identity Open · Scan
M08586_2.00 NN 70-40% CisBP TTTTATTTCTTCTATTCTCTA 51.5% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 194 aa
15-121

Region 15-121 0 PWM

Residues
107 aa
Domains
PF00447 · HSF-type DNA-binding
3D models
1 active PDB
Templates
5D5V
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 15-1211 model
Actions
Predicted = Low TFS_E5RG51:15:121_5d5v_D_1 5d5v 15-121 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
20-120PF00447HSF-type DNA-bindingoverlaps 15-121