Transcription factor

E5RG51 - HSF4

Heat shock transcription factor 4

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 194 aa

9 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
MA0771.1	NN 70+%	JASPAR	TTCTAGAACGTTC	98.6% identity		Open · Scan

Nearest Neighbor (70% - 40%)8

Motif	Prediction	Source	DNA binding	Support	Actions
M03330_2.00	NN 70-40%	CisBP	GAACGTTCTAGAA	69.4% identity	Open · Scan
M01257_2.00	NN 70-40%	CisBP	AATCTTCCAT	68.4% identity	Open · Scan
MA0486.1	NN 70-40%	JASPAR	CTTCTAGAAGGTTCT	67.9% identity	Open · Scan
M02248_2.00	NN 70-40%	CisBP	GAATGTTCTATAT	57.4% identity	Open · Scan
M05506_2.00	NN 70-40%	CisBP	GGAACGTTCTAGAAC	56.0% identity	Open · Scan
MA0770.1	NN 70-40%	JASPAR	TTCTAGAACGTTC	56.0% identity	Open · Scan
M06388_2.00	NN 70-40%	CisBP	TCGAAACTTCTAGA	52.3% identity	Open · Scan
M08586_2.00	NN 70-40%	CisBP	TTTTATTTCTTCTATTCTCTA	51.5% identity	Open · Scan

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 194 aa

15-121

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 15-1211 model

				Actions
Predicted = Low	TFS_E5RG51:15:121_5d5v_D_1	5d5v	15-121	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
20-120	PF00447	HSF-type DNA-binding	overlaps 15-121