ModCRE DB

Transcription factor

E5RH37 - ZFAT

Zinc finger protein ZFAT (Zinc finger protein 406)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 998 aa

7 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M07842_2.00 NN 70-40% CisBP CTCACCTG 61.7% identity Open · Scan
ModCRE6
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_tr_E5RH37_E5RH37_HUMAN:906:956_1llm_C_1 ModCRE Homology model CCGCGCGGCGAA Region 906-956 · 1 3D model Open · Scan
TFS_tr_E5RH37_E5RH37_HUMAN:743:955_8ssu_A_1 ModCRE Homology model TCACTCCGCCCCGGGCCAT Region 743-955 · 1 3D model Open · Scan
TFS_tr_E5RH37_E5RH37_HUMAN:805:990_8sss_A_1 ModCRE Homology model GGGGCGCCTCCGGGGCCCCCAGA Region 805-990 · 1 3D model Open · Scan
TFS_tr_E5RH37_E5RH37_HUMAN:805:990_8sst_A_1 ModCRE Homology model CCCGCGGGGCGGGCCCCCCGAGG Region 805-990 · 1 3D model Open · Scan
TFS_tr_E5RH37_E5RH37_HUMAN:805:991_7w1m_H_1 ModCRE Homology model TGGGGCCCCACTGGGGGGGCACGAGCCTG Region 805-991 · 1 3D model Open · Scan
TFS_tr_E5RH37_E5RH37_HUMAN:877:991_5t0u_A_1 ModCRE Homology model AACACTCGGGCCTTGCGG Region 877-991 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 998 aa
743-991

Region 743-991 6 PWM

Residues
249 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 5T0U, 7W1M, 8SSS, 8SST, 8SSU
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 743-9916 models · 6 summary rows
Actions
Predicted = Low DIMER_tr_E5RH37_E5RH37_HUMAN:906:956_1llm_C_1 1llm 906-956 View model · PDB
Predicted = Low TFS_tr_E5RH37_E5RH37_HUMAN:743:955_8ssu_A_1 8ssu 743-955 View model · PDB
Predicted = Low TFS_tr_E5RH37_E5RH37_HUMAN:805:990_8sss_A_1 8sss 805-990 View model · PDB
Predicted = Low TFS_tr_E5RH37_E5RH37_HUMAN:805:990_8sst_A_1 8sst 805-990 View model · PDB
Predicted = Low TFS_tr_E5RH37_E5RH37_HUMAN:805:991_7w1m_H_1 7w1m 805-991 View model · PDB
Predicted = Low TFS_tr_E5RH37_E5RH37_HUMAN:877:991_5t0u_A_1 5t0u 877-991 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
4 5t0u 743:992 877 991 P:A · DNA:B,C 41.4% / 56.0% 67 View · PDB TFS_tr_E5RH37_E5RH37_HUMAN:877:991_5t0u_A_1
1 1llm 743:992 906,906 956,956 P:C,D · DNA:A,B 35.3% / 52.9% 58,60 View · PDB DIMER_tr_E5RH37_E5RH37_HUMAN:906:956_1llm_C_1
1 8sst 743:992 805 990 P:A · DNA:B,C 34.5% / 52.1% 92 View · PDB TFS_tr_E5RH37_E5RH37_HUMAN:805:990_8sst_A_1
2 8sss 743:992 805 990 P:A · DNA:B,C 34.5% / 52.1% 92 View · PDB TFS_tr_E5RH37_E5RH37_HUMAN:805:990_8sss_A_1
3 7w1m 743:992 805 991 P:H · DNA:F,G 34.4% / 52.3% 57 View · PDB TFS_tr_E5RH37_E5RH37_HUMAN:805:991_7w1m_H_1
5 8ssu 743:992 743 955 P:A · DNA:B,C 29.9% / 45.5% 89 View · PDB TFS_tr_E5RH37_E5RH37_HUMAN:743:955_8ssu_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
271-293PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
299-322PF13909C2H2-type zinc-finger domainNo overlap with loaded model regions
909-931PF00096Zinc finger, C2H2 typeoverlaps 743-991
939-959PF00096Zinc finger, C2H2 typeoverlaps 743-991