Transcription factor

E5RI93 - ZFHX4

Zinc finger homeobox 4

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 1665 aa

8 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)3

Motif	Prediction	Source	DNA binding	Support	Actions
M02108_2.00	NN 70-40%	CisBP	CCTAATTAG	60.6% identity	Open · Scan
M06068_2.00	NN 70-40%	CisBP	GGGAATCCCCT	57.1% identity	Open · Scan
M01849_2.00	NN 70-40%	CisBP	ACTAATTAG	56.6% identity	Open · Scan

ModCRE5

Motif	Prediction	Source	DNA binding	Support	Actions
TFS_tr_E5RI93_E5RI93_HUMAN:1570:1613_7eyi_H_1	ModCRE	Homology model	GTTTCAATATTCC	Region 1570-1613 · 1 3D model	Open · Scan
TFS_tr_E5RI93_E5RI93_HUMAN:610:727_5kkq_A_1	ModCRE	Homology model	TTGAGGGAGCCTGGGAT	Region 610-727 · 1 3D model	Open · Scan
TFS_tr_E5RI93_E5RI93_HUMAN:614:727_8sss_A_1	ModCRE	Homology model	GTATGGAAAGGCGCCTGCTAGT	Region 614-727 · 1 3D model	Open · Scan
TFS_tr_E5RI93_E5RI93_HUMAN:614:727_8sst_A_1	ModCRE	Homology model	GGCTGGGCAGGCGCCGGCTAGT	Region 614-727 · 1 3D model	Open · Scan
TFS_tr_E5RI93_E5RI93_HUMAN:615:719_5yel_B_1	ModCRE	Homology model	GTAAATTTAAGCAAGCGCGTACAA	Region 615-719 · 1 3D model	Open · Scan

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1665 aa

610-727

1397-1448

1570-1613

Scan this region Show models

Scan this region Show models

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

6 active PDB models 6 summary rows

Region 610-7274 models · 4 summary rows

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
3	8sst	598:727	614	727	P:A · DNA:B,C	27.8% / 41.7%	56	View · PDB TFS_tr_E5RI93_E5RI93_HUMAN:614:727_8sst_A_1
5	5kkq	598:727	610	727	P:A · DNA:B,C	27.7% / 41.2%	78	View · PDB TFS_tr_E5RI93_E5RI93_HUMAN:610:727_5kkq_A_1
2	5yel	598:727	615	719	P:B · DNA:C,D	27.4% / 39.6%	61	View · PDB TFS_tr_E5RI93_E5RI93_HUMAN:615:719_5yel_B_1
1	8sss	598:727	614	727	P:A · DNA:B,C	27.0% / 40.9%	56	View · PDB TFS_tr_E5RI93_E5RI93_HUMAN:614:727_8sss_A_1

Region 1397-14481 model · 1 summary row

				Actions
Predicted = Low	DIMER_tr_E5RI93_E5RI93_HUMAN:1397:1448_1llm_D_1	1llm	1397-1448	View model · PDB

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
1	1llm	598:727	1397,1397	1448,1448	P:C,D · DNA:A,B	25.0% / 38.5%	59,61	View · PDB DIMER_tr_E5RI93_E5RI93_HUMAN:1397:1448_1llm_D_1

Region 1570-16131 model · 1 summary row

				Actions
Predicted = Low	TFS_tr_E5RI93_E5RI93_HUMAN:1570:1613_7eyi_H_1	7eyi	1570-1613	View model · PDB

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
4	7eyi	598:727	1570	1613	P:H · DNA:C,D	38.6% / 68.2%	38	View · PDB TFS_tr_E5RI93_E5RI93_HUMAN:1570:1613_7eyi_H_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
645-667	PF00096	Zinc finger, C2H2 type	overlaps 610-727
699-723	PF00096	Zinc finger, C2H2 type	overlaps 610-727
999-1023	PF24056	Zinc finger homeobox protein 3-like, C2H2 type zinc-finger	No overlap with loaded model regions
1593-1617	PF00096	Zinc finger, C2H2 type	overlaps 1570-1613