Transcription factor

E7EN86 - ZNF143

Zinc finger protein 143 (Selenocysteine tRNA gene transcription-activating factor)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 610 aa

13 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)2

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
MA0088.2	NN 70+%	JASPAR	TACCCACAATGCATTG	95.4% identity		Open · Scan
MA0088.1	NN 70+%	JASPAR	GATTTCCCATAATGCCTTGC	71.6% identity		Open · Scan

Nearest Neighbor (70% - 40%)11

Motif	Prediction	Source	DNA binding	Support	Actions
M00948_2.00	NN 70-40%	CisBP	GCAGCACC	56.3% identity	Open · Scan
M00950_2.00	NN 70-40%	CisBP	GCAGCCCA	56.3% identity	Open · Scan
M00952_2.00	NN 70-40%	CisBP	GGATGCTC	56.3% identity	Open · Scan
M00958_2.00	NN 70-40%	CisBP	CGGCATCCC	56.3% identity	Open · Scan
M00960_2.00	NN 70-40%	CisBP	TGCATCCC	56.3% identity	Open · Scan
M00953_2.00	NN 70-40%	CisBP	ATCTATAT	54.9% identity	Open · Scan
M00645_2.00	NN 70-40%	CisBP	CGCCCACGCA	51.7% identity	Open · Scan
M00944_2.00	NN 70-40%	CisBP	TCGCTATAA	51.6% identity	Open · Scan
M06068_2.00	NN 70-40%	CisBP	GGGAATCCCCT	51.2% identity	Open · Scan
M01436_2.00	NN 70-40%	CisBP	TACCCCTTA	50.8% identity	Open · Scan
M00951_2.00	NN 70-40%	CisBP	GCTGCACG	50.5% identity	Open · Scan

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 610 aa

206-419

Residues: 214 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models: 1 active PDB
Templates: 5V3J
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 206-4191 model

				Actions
Predicted = Low	TFS_E7EN86:206:419_5v3j_E_1	5v3j	206-419	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
209-233	PF00096	Zinc finger, C2H2 type	overlaps 206-419
239-263	PF00096	Zinc finger, C2H2 type	overlaps 206-419
269-293	PF00096	Zinc finger, C2H2 type	overlaps 206-419
329-353	PF00096	Zinc finger, C2H2 type	overlaps 206-419
389-412	PF00096	Zinc finger, C2H2 type	overlaps 206-419