ModCRE DB

Transcription factor

E7EQD3 - ZNF304

Zinc finger protein 304

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 706 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M07587_2.00 Known CisBP CCCCCTCCCCAGTCGAGCCCCCGC Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 706 aa
325-486

Region 325-486 0 PWM

Residues
162 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5T0U
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 325-4861 model
Actions
Predicted = Low TFS_E7EQD3:325:486_5t0u_A_1 5t0u 325-486 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
13-53PF01352KRAB boxNo overlap with loaded model regions
326-348PF00096Zinc finger, C2H2 typeoverlaps 325-486
354-376PF00096Zinc finger, C2H2 typeoverlaps 325-486
382-404PF00096Zinc finger, C2H2 typeoverlaps 325-486
410-432PF00096Zinc finger, C2H2 typeoverlaps 325-486
438-460PF00096Zinc finger, C2H2 typeoverlaps 325-486
466-488PF00096Zinc finger, C2H2 typeoverlaps 325-486
522-544PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
550-572PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
578-600PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
606-628PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
634-656PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
662-684PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions