ModCRE DB

Transcription factor

E7ES08 - HMGB3

High mobility group protein B3 (High mobility group protein 2a) (High mobility group protein 4)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 188 aa

6 Generated PWM 5 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M08606_2.00 NN 70-40% CisBP TCATTTTTATATATAGGTCAT 52.8% identity Open · Scan
ModCRE5
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_E7ES08_E7ES08_HUMAN:10:155_5ze0_N_1 ModCRE Homology model GCCGGGAAATCCAGGCCCGCCGTTCATATCCCA Region 10-155 · 1 3D model Open · Scan
TFS_tr_E7ES08_E7ES08_HUMAN:11:155_5zdz_N_1 ModCRE Homology model GATAGGAAGTCAGGGTAGACTTTGCATAAGGCA Region 11-155 · 1 3D model Open · Scan
TFS_tr_E7ES08_E7ES08_HUMAN:11:155_5ze1_N_1 ModCRE Homology model GCGGGGAAATCCGGGATGATATTTCAGCCCAG Region 11-155 · 1 3D model Open · Scan
TFS_tr_E7ES08_E7ES08_HUMAN:11:155_5ze2_N_1 ModCRE Homology model TTCGGGAAGTCAGGGAGGGTGGCCCCCGCAGCA Region 11-155 · 1 3D model Open · Scan
TFS_tr_E7ES08_E7ES08_HUMAN:9:156_6cij_N_1 ModCRE Homology model CTCGGAAAATTTATATGACGCCGGAGGGGT Region 9-156 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 188 aa
9-156

Region 9-156 5 PWM

Residues
148 aa
Domains
PF09011 · HMG-box domain PF00505 · HMG (high mobility group) box
3D models
5 active PDBs · 5 summary rows
Templates
5ZDZ, 5ZE0, 5ZE1, 5ZE2, 6CIJ
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
5 active PDB models 5 summary rows
Region 9-1565 models · 5 summary rows
Actions
Predicted = Low TFS_tr_E7ES08_E7ES08_HUMAN:10:155_5ze0_N_1 5ze0 10-155 View model · PDB
Predicted = Low TFS_tr_E7ES08_E7ES08_HUMAN:11:155_5zdz_N_1 5zdz 11-155 View model · PDB
Predicted = Low TFS_tr_E7ES08_E7ES08_HUMAN:11:155_5ze1_N_1 5ze1 11-155 View model · PDB
Predicted = Low TFS_tr_E7ES08_E7ES08_HUMAN:11:155_5ze2_N_1 5ze2 11-155 View model · PDB
Predicted = Low TFS_tr_E7ES08_E7ES08_HUMAN:9:156_6cij_N_1 6cij 9-156 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 6cij 8:165 9 156 P:N · DNA:G,M 72.0% / 79.3% 98 View · PDB TFS_tr_E7ES08_E7ES08_HUMAN:9:156_6cij_N_1
3 5ze2 8:165 11 155 P:N · DNA:G,M 65.3% / 71.4% 100 View · PDB TFS_tr_E7ES08_E7ES08_HUMAN:11:155_5ze2_N_1
4 5ze1 8:165 11 155 P:N · DNA:G,M 65.3% / 71.4% 100 View · PDB TFS_tr_E7ES08_E7ES08_HUMAN:11:155_5ze1_N_1
5 5zdz 8:165 11 155 P:N · DNA:G,M 65.3% / 71.4% 100 View · PDB TFS_tr_E7ES08_E7ES08_HUMAN:11:155_5zdz_N_1
2 5ze0 8:165 10 155 P:N · DNA:G,M 64.9% / 71.6% 100 View · PDB TFS_tr_E7ES08_E7ES08_HUMAN:10:155_5ze0_N_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
6-78PF09011HMG-box domainoverlaps 9-156
93-161PF00505HMG (high mobility group) boxoverlaps 9-156