ModCRE DB

Transcription factor

E7EUW9 - ZEB2

Zinc finger E-box-binding homeobox 2 (Smad-interacting protein 1) (Zinc finger homeobox protein 1b)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 731 aa

25 Generated PWM 12 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)15
MotifPredictionSourceDNA bindingSupportLogoActions
M04463_2.00 NN 70-40% CisBP CACCACGCCCA 61.5% identity Open · Scan
MA0039.1 NN 70-40% JASPAR TAAAGGAAGG 61.5% identity Open · Scan
MA0039.3 NN 70-40% JASPAR CCACACCCTGC 61.5% identity Open · Scan
MA1515.1 NN 70-40% JASPAR CACCACGCCCA 61.5% identity Open · Scan
M07842_2.00 NN 70-40% CisBP CTCACCTG 60.6% identity Open · Scan
M04611_2.00 NN 70-40% CisBP CTTTCGGACAC 57.5% identity Open · Scan
M04651_2.00 NN 70-40% CisBP TTCACTATTATAGTGAA 57.5% identity Open · Scan
M06179_2.00 NN 70-40% CisBP TAAGCCTATAGA 56.8% identity Open · Scan
M00019_2.00 NN 70-40% CisBP ACCCCTAATT 54.0% identity Open · Scan
M00142_2.00 NN 70-40% CisBP GTGCTCCT 53.6% identity Open · Scan
M04465_2.00 NN 70-40% CisBP GTGATTCTTATCTTATCCTT 53.3% identity Open · Scan
M01468_2.00 NN 70-40% CisBP TTACCCCTGA 50.0% identity Open · Scan
M01531_2.00 NN 70-40% CisBP CCCCCCCTAAAT 50.0% identity Open · Scan
M07625_2.00 NN 70-40% CisBP TCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 50.0% identity Open · Scan
M08295_2.00 NN 70-40% CisBP CTGCTGGAATCTCCA 50.0% identity Open · Scan
ModCRE10
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_tr_E7EUW9_E7EUW9_HUMAN:309:357_1llm_C_1 ModCRE Homology model TAGGCGCGCGGA Region 309-357 · 1 3D model Open · Scan
DIMER_tr_E7EUW9_E7EUW9_HUMAN:688:725_1au7_B_1 ModCRE Homology model TCTTTAAAGAGAAGAGGTTAAAAA Region 688-725 · 1 3D model Open · Scan
DIMER_tr_E7EUW9_E7EUW9_HUMAN:688:725_1hf0_B_1 ModCRE Homology model TATAATAAGGAAATCTTTTAAG Region 688-725 · 1 3D model Open · Scan
DIMER_tr_E7EUW9_E7EUW9_HUMAN:688:725_5wc9_A_1 ModCRE Homology model GCTCACAGGCCCCACGGG Region 688-725 · 1 3D model Open · Scan
TFS_tr_E7EUW9_E7EUW9_HUMAN:242:293_5k5l_F_1 ModCRE Homology model GTAACACACTCGTA Region 242-293 · 1 3D model Open · Scan
TFS_tr_E7EUW9_E7EUW9_HUMAN:242:361_5kkq_A_1 ModCRE Homology model CCGGCTAGTTGGTGGAA Region 242-361 · 1 3D model Open · Scan
TFS_tr_E7EUW9_E7EUW9_HUMAN:242:361_5t00_A_1 ModCRE Homology model CCGGCAGCGCGTTGGGA Region 242-361 · 1 3D model Open · Scan
TFS_tr_E7EUW9_E7EUW9_HUMAN:242:361_5t0u_A_1 ModCRE Homology model GGATCGCGCAGCGCTAGGGTAA Region 242-361 · 1 3D model Open · Scan
TFS_tr_E7EUW9_E7EUW9_HUMAN:242:361_5yef_A_1 ModCRE Homology model ACAAACCGGGGGCCCGGGAAAAT Region 242-361 · 1 3D model Open · Scan
TFS_tr_E7EUW9_E7EUW9_HUMAN:242:361_8sss_A_1 ModCRE Homology model GAACCTGGCGCGCGCTGCGAAA Region 242-361 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 731 aa
242-361
688-725

Region 242-361 7 PWM

Residues
120 aa
Domains
PF05605 · Drought induced 19 protein (Di19), zinc-binding PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
9 active PDBs · 6 summary rows
Templates
1LLM, 5K5L, 5KKQ, 5T00, 5T0U, 5YEF, 8SSS
Sources
Predicted = Low
Scan this region Show models

Region 688-725 3 PWM

Residues
38 aa
Domains
No overlapping PFAM annotation recorded
3D models
3 active PDBs · 3 summary rows
Templates
1AU7, 1HF0, 5WC9
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
12 active PDB models 9 summary rows
Region 242-3619 models · 6 summary rows
Actions
Predicted = Low DIMER_tr_E7EUW9_E7EUW9_HUMAN:309:357_1llm_C_1 1llm 309-357 View model · PDB
Predicted = Low TFS_tr_E7EUW9_E7EUW9_HUMAN:242:293_5k5l_F_1 5k5l 242-293 View model · PDB
Predicted = Low TFS_tr_E7EUW9_E7EUW9_HUMAN:242:361_5kkq_A_1 5kkq 242-361 View model · PDB
Predicted = Low TFS_tr_E7EUW9_E7EUW9_HUMAN:242:361_5t00_A_1 5t00 242-361 View model · PDB
Predicted = Low TFS_tr_E7EUW9_E7EUW9_HUMAN:242:361_5t0u_A_1 5t0u 242-361 View model · PDB
Predicted = Low TFS_tr_E7EUW9_E7EUW9_HUMAN:242:361_5yef_A_1 5yef 242-361 View model · PDB
Predicted = Low TFS_tr_E7EUW9_E7EUW9_HUMAN:242:361_5yef_B_1 5yef 242-361 View model · PDB
Predicted = Low TFS_tr_E7EUW9_E7EUW9_HUMAN:242:361_5yef_J_1 5yef 242-361 View model · PDB
Predicted = Low TFS_tr_E7EUW9_E7EUW9_HUMAN:242:361_8sss_A_1 8sss 242-361 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 1llm 242:365 309,309 357,357 P:C,D · DNA:A,B 36.7% / 55.1% 56,57 View · PDB DIMER_tr_E7EUW9_E7EUW9_HUMAN:309:357_1llm_C_1
1 5kkq 242:365 242 361 P:A · DNA:B,C 36.7% / 51.7% 72 View · PDB TFS_tr_E7EUW9_E7EUW9_HUMAN:242:361_5kkq_A_1
2 5t00 242:365 242 361 P:A · DNA:B,C 36.7% / 51.7% 74 View · PDB TFS_tr_E7EUW9_E7EUW9_HUMAN:242:361_5t00_A_1
3 5t0u 242:365 242 361 P:A · DNA:B,C 36.7% / 51.7% 62 View · PDB TFS_tr_E7EUW9_E7EUW9_HUMAN:242:361_5t0u_A_1
4 8sss 242:365 242 361 P:A · DNA:B,C 36.7% / 51.7% 53 View · PDB TFS_tr_E7EUW9_E7EUW9_HUMAN:242:361_8sss_A_1
5 5yef 242:365 242 361 P:A · DNA:C,D 36.7% / 51.7% 62 View · PDB TFS_tr_E7EUW9_E7EUW9_HUMAN:242:361_5yef_A_1
Region 688-7253 models · 3 summary rows
Actions
Predicted = Low DIMER_tr_E7EUW9_E7EUW9_HUMAN:688:725_1au7_B_1 1au7 688-725 View model · PDB
Predicted = Low DIMER_tr_E7EUW9_E7EUW9_HUMAN:688:725_1hf0_B_1 1hf0 688-725 View model · PDB
Predicted = Low DIMER_tr_E7EUW9_E7EUW9_HUMAN:688:725_5wc9_A_1 5wc9 688-725 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
2 1au7 242:365 688,688 725,725 P:A,B · DNA:C,D 26.3% / 65.8% 29,29 View · PDB DIMER_tr_E7EUW9_E7EUW9_HUMAN:688:725_1au7_B_1
4 5wc9 242:365 688,688 725,725 P:A,B · DNA:C,D 26.3% / 63.2% 27,28 View · PDB DIMER_tr_E7EUW9_E7EUW9_HUMAN:688:725_5wc9_A_1
3 1hf0 242:365 688,688 725,725 P:A,B · DNA:M,N 26.3% / 57.9% 29,29 View · PDB DIMER_tr_E7EUW9_E7EUW9_HUMAN:688:725_1hf0_B_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
240-291PF05605Drought induced 19 protein (Di19), zinc-bindingoverlaps 242-361
311-333PF00096Zinc finger, C2H2 typeoverlaps 242-361
339-359PF00096Zinc finger, C2H2 typeoverlaps 242-361