Transcription factor

E7EX64 - ZNF76

Zinc finger protein 76

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 340 aa

13 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)8

Motif	Prediction	Source	DNA binding	Support	Actions
MA0088.1	NN 70-40%	JASPAR	GATTTCCCATAATGCCTTGC	65.6% identity	Open · Scan
MA0088.2	NN 70-40%	JASPAR	TACCCACAATGCATTG	65.3% identity	Open · Scan
M00950_2.00	NN 70-40%	CisBP	GCAGCCCA	58.2% identity	Open · Scan
M00953_2.00	NN 70-40%	CisBP	ATCTATAT	56.0% identity	Open · Scan
MA0752.1	NN 70-40%	JASPAR	TCCATCCCATAATACTC	52.9% identity	Open · Scan
M00944_2.00	NN 70-40%	CisBP	TCGCTATAA	52.7% identity	Open · Scan
M06466_2.00	NN 70-40%	CisBP	TCCGCCCCCT	50.6% identity	Open · Scan
M04387_2.00	NN 70-40%	CisBP	CGTGCTCCCC	50.0% identity	Open · Scan

ModCRE5

Motif	Prediction	Source	DNA binding	Support	Actions
TFS_tr_E7EX64_E7EX64_HUMAN:161:340_5v3j_E_1	ModCRE	Homology model	TGGGCCGGGGGGGTGCAGGCCCCAAA	Region 161-340 · 1 3D model	Open · Scan
TFS_tr_E7EX64_E7EX64_HUMAN:161:340_5v3m_C_1	ModCRE	Homology model	CGGCAGTGGGGGGGCAGGCCCCAAG	Region 161-340 · 1 3D model	Open · Scan
TFS_tr_E7EX64_E7EX64_HUMAN:161:340_5wjq_D_1	ModCRE	Homology model	AGGAACAGGGGGGGTCCGGCCGCCGA	Region 161-340 · 1 3D model	Open · Scan
TFS_tr_E7EX64_E7EX64_HUMAN:176:339_2i13_A_1	ModCRE	Homology model	ACTTAGCTGCTACTTCTTCTG	Region 176-339 · 1 3D model	Open · Scan
TFS_tr_E7EX64_E7EX64_HUMAN:223:340_6wmi_A_1	ModCRE	Homology model	GAGGGACCCCCCCGACC	Region 223-340 · 1 3D model	Open · Scan

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 340 aa

161-340

Residues: 180 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models: 6 active PDBs · 6 summary rows
Templates: 1LLM, 2I13, 5V3J, 5V3M, 5WJQ, 6WMI
Sources: Predicted = Low

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

6 active PDB models 6 summary rows

Region 161-3406 models · 6 summary rows

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
2	6wmi	161:340	223	340	P:A · DNA:E,F	52.5% / 65.3%	80	View · PDB TFS_tr_E7EX64_E7EX64_HUMAN:223:340_6wmi_A_1
1	2i13	161:340	176	339	P:A · DNA:C,D	48.8% / 61.6%	100	View · PDB TFS_tr_E7EX64_E7EX64_HUMAN:176:339_2i13_A_1
1	1llm	161:340	223,223	275,275	P:C,D · DNA:A,B	47.2% / 60.4%	56,57	View · PDB DIMER_tr_E7EX64_E7EX64_HUMAN:223:275_1llm_D_1
3	5v3m	161:340	161	340	P:C · DNA:A,B	41.1% / 58.3%	60	View · PDB TFS_tr_E7EX64_E7EX64_HUMAN:161:340_5v3m_C_1
4	5v3j	161:340	161	340	P:E · DNA:A,B	41.1% / 58.3%	60	View · PDB TFS_tr_E7EX64_E7EX64_HUMAN:161:340_5v3j_E_1
5	5wjq	161:340	161	340	P:D · DNA:A,B	40.6% / 57.8%	59	View · PDB TFS_tr_E7EX64_E7EX64_HUMAN:161:340_5wjq_D_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
195-219	PF00096	Zinc finger, C2H2 type	overlaps 161-340
225-249	PF00096	Zinc finger, C2H2 type	overlaps 161-340
285-309	PF00096	Zinc finger, C2H2 type	overlaps 161-340
315-339	PF00096	Zinc finger, C2H2 type	overlaps 161-340