ModCRE DB

Transcription factor

E9PJ73 - BATF2

Basic leucine zipper transcriptional factor ATF-like 2

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 155 aa

6 Generated PWM 5 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)1
MotifPredictionSourceDNA bindingSupportLogoActions
MA0462.1 NN 70-40% JASPAR GAAATGACTCA 51.3% identity Open · Scan
ModCRE5
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_tr_E9PJ73_E9PJ73_HUMAN:19:66_1dh3_C_1 ModCRE Homology model AAAAAGTGGGGTCACATTTG Region 19-66 · 1 3D model Open · Scan
DIMER_tr_E9PJ73_E9PJ73_HUMAN:21:37_2c9l_Y_1 ModCRE Homology model GCCTCTGAGTCAGGGGGG Region 21-37 · 1 3D model Open · Scan
TFS_tr_E9PJ73_E9PJ73_HUMAN:19:66_1dh3_C_1 ModCRE Homology model AAAAAGTGGGGTCACATTTG Region 19-66 · 1 3D model Open · Scan
TFS_tr_E9PJ73_E9PJ73_HUMAN:23:45_1skn_P_1 ModCRE Homology model TCAAATTGATTTT Region 23-45 · 1 3D model Open · Scan
TFS_tr_E9PJ73_E9PJ73_HUMAN:25:70_1t2k_D_1 ModCRE Homology model AAAAGGGGGTCATTT Region 25-70 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 155 aa
19-70

Region 19-70 5 PWM

Residues
52 aa
Domains
PF00170 · bZIP transcription factor
3D models
5 active PDBs · 4 summary rows
Templates
1DH3, 1SKN, 1T2K, 2C9L
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
5 active PDB models 4 summary rows
Region 19-705 models · 4 summary rows
Actions
Predicted = Low DIMER_tr_E9PJ73_E9PJ73_HUMAN:19:66_1dh3_C_1 1dh3 19-66 View model · PDB
Predicted = Low DIMER_tr_E9PJ73_E9PJ73_HUMAN:21:37_2c9l_Y_1 2c9l 21-37 View model · PDB
Predicted = Low TFS_tr_E9PJ73_E9PJ73_HUMAN:19:66_1dh3_C_1 1dh3 19-66 View model · PDB
Predicted = Low TFS_tr_E9PJ73_E9PJ73_HUMAN:23:45_1skn_P_1 1skn 23-45 View model · PDB
Predicted = Low TFS_tr_E9PJ73_E9PJ73_HUMAN:25:70_1t2k_D_1 1t2k 25-70 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 1t2k 19:70 25 70 P:D · DNA:E,F 40.4% / 57.4% 75 View · PDB TFS_tr_E9PJ73_E9PJ73_HUMAN:25:70_1t2k_D_1
3 1skn 19:70 23 45 P:P · DNA:A,B 39.1% / 69.6% 31 View · PDB TFS_tr_E9PJ73_E9PJ73_HUMAN:23:45_1skn_P_1
1 1dh3 19:70 19,19 66,66 P:A,C · DNA:B,D 32.7% / 61.2% 87,87 View · PDB DIMER_tr_E9PJ73_E9PJ73_HUMAN:19:66_1dh3_C_1
2 1dh3 19:70 19,19 66,66 P:A,C · DNA:B,D 32.7% / 61.2% 87,87 View · PDB TFS_tr_E9PJ73_E9PJ73_HUMAN:19:66_1dh3_C_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
16-68PF00170bZIP transcription factoroverlaps 19-70