ModCRE DB

Transcription factor

E9PKP7 - UBTF

Nucleolar transcription factor 1 (Upstream-binding factor 1)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 745 aa

4 Generated PWM 10 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE4
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_E9PKP7_E9PKP7_HUMAN:233:337_3tq6_A_1 ModCRE Homology model TTTTGAAACCACTTTTTAAACC Region 233-337 · 1 3D model Open · Scan
TFS_tr_E9PKP7_E9PKP7_HUMAN:233:337_6erp_C_1 ModCRE Homology model GGGTTTGGTTATTGGTCAGTCTTTAAAC Region 233-337 · 1 3D model Open · Scan
TFS_tr_E9PKP7_E9PKP7_HUMAN:233:337_6erq_C_1 ModCRE Homology model TTTCTGTACAATTGCCCCTGGAAATCTT Region 233-337 · 1 3D model Open · Scan
TFS_tr_E9PKP7_E9PKP7_HUMAN:233:337_6hb4_A_1 ModCRE Homology model CCTGGGGCCCGGCTATAAACCG Region 233-337 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 745 aa
112-181
233-337

Region 112-181 0 PWM

Residues
70 aa
Domains
PF00505 · HMG (high mobility group) box
3D models
5 active PDBs · 5 summary rows
Templates
3TMM, 3TQ6, 6ERP, 6ERQ, 7LBX
Sources
Predicted = Low
Scan this region Show models

Region 233-337 4 PWM

Residues
105 aa
Domains
PF09011 · HMG-box domain
3D models
5 active PDBs
Templates
3TQ6, 4NNU, 6ERP, 6ERQ, 6HB4
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
10 active PDB models 5 summary rows
Region 112-1815 models · 5 summary rows
Actions
Predicted = Low TFS_tr_E9PKP7_E9PKP7_HUMAN:112:181_3tmm_A_1 3tmm 112-181 View model · PDB
Predicted = Low TFS_tr_E9PKP7_E9PKP7_HUMAN:112:181_3tq6_A_1 3tq6 112-181 View model · PDB
Predicted = Low TFS_tr_E9PKP7_E9PKP7_HUMAN:112:181_6erp_C_1 6erp 112-181 View model · PDB
Predicted = Low TFS_tr_E9PKP7_E9PKP7_HUMAN:112:181_6erq_C_1 6erq 112-181 View model · PDB
Predicted = Low TFS_tr_E9PKP7_E9PKP7_HUMAN:112:181_7lbx_B_1 7lbx 112-181 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 6erq 112:181 112 181 P:C · DNA:D,E 30.0% / 61.4% 36 View · PDB TFS_tr_E9PKP7_E9PKP7_HUMAN:112:181_6erq_C_1
2 6erp 112:181 112 181 P:C · DNA:D,E 30.0% / 61.4% 36 View · PDB TFS_tr_E9PKP7_E9PKP7_HUMAN:112:181_6erp_C_1
3 3tq6 112:181 112 181 P:A · DNA:C,D 30.0% / 61.4% 36 View · PDB TFS_tr_E9PKP7_E9PKP7_HUMAN:112:181_3tq6_A_1
4 3tmm 112:181 112 181 P:A · DNA:B,C 30.0% / 61.4% 35 View · PDB TFS_tr_E9PKP7_E9PKP7_HUMAN:112:181_3tmm_A_1
5 7lbx 112:181 112 181 P:B · DNA:C,D,E,F 30.0% / 61.4% 37 View · PDB TFS_tr_E9PKP7_E9PKP7_HUMAN:112:181_7lbx_B_1
Region 233-3375 models
Actions
Predicted = Low TFS_tr_E9PKP7_E9PKP7_HUMAN:233:337_3tq6_A_1 3tq6 233-337 View model · PDB
Predicted = Low TFS_tr_E9PKP7_E9PKP7_HUMAN:233:337_4nnu_B_1 4nnu 233-337 View model · PDB
Predicted = Low TFS_tr_E9PKP7_E9PKP7_HUMAN:233:337_6erp_C_1 6erp 233-337 View model · PDB
Predicted = Low TFS_tr_E9PKP7_E9PKP7_HUMAN:233:337_6erq_C_1 6erq 233-337 View model · PDB
Predicted = Low TFS_tr_E9PKP7_E9PKP7_HUMAN:233:337_6hb4_A_1 6hb4 233-337 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
112-179PF00505HMG (high mobility group) boxoverlaps 112-181
262-320PF09011HMG-box domainoverlaps 233-337
370-431PF00505HMG (high mobility group) boxNo overlap with loaded model regions
442-526PF14887HMG (high mobility group) box 5No overlap with loaded model regions