Region 9-55 2 PWM
- Residues
- 47 aa
- Domains
- PF00808 · Histone-like transcription factor (CBF/NF-Y) and archaeal histone
- 3D models
- 7 active PDBs · 5 summary rows
- Templates
- 1JFI, 4AWL, 4G92, 4WZS, 6R2V, 7C9O, 7CVQ
- Sources
- Predicted = Low
Transcription factor
E9PNC7 - DRAP1
Dr1-associated corepressor (Dr1-associated protein 1) (Negative cofactor 2-alpha)
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 155 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known0
No generated PWM in this category.
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)0
No generated PWM in this category.
ModCRE2
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| TFS_tr_E9PNC7_E9PNC7_HUMAN:11:53_4g92_C_1 | ModCRE | Homology model | AGGGGTACTTTTAAAATAAAAA | Region 11-53 · 1 3D model | Open · Scan | |
| TFS_tr_E9PNC7_E9PNC7_HUMAN:13:53_4awl_C_1 | ModCRE | Homology model | AAAAAAGAATTTCCAAAATTTTTCT | Region 13-53 · 1 3D model | Open · Scan |
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
155 aa
9-55
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
7 active PDB models
5 summary rows
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 9-557 models · 5 summary rows
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | TFS_tr_E9PNC7_E9PNC7_HUMAN:10:55_1jfi_A_1 | 1jfi | 10-55 | View model · PDB |
| Predicted = Low | TFS_tr_E9PNC7_E9PNC7_HUMAN:11:49_7c9o_C_1 | 7c9o | 11-49 | View model · PDB |
| Predicted = Low | TFS_tr_E9PNC7_E9PNC7_HUMAN:11:53_4g92_C_1 | 4g92 | 11-53 | View model · PDB |
| Predicted = Low | TFS_tr_E9PNC7_E9PNC7_HUMAN:13:50_4wzs_A_1 | 4wzs | 13-50 | View model · PDB |
| Predicted = Low | TFS_tr_E9PNC7_E9PNC7_HUMAN:13:53_4awl_C_1 | 4awl | 13-53 | View model · PDB |
| Predicted = Low | TFS_tr_E9PNC7_E9PNC7_HUMAN:9:49_6r2v_C_1 | 6r2v | 9-49 | View model · PDB |
| Predicted = Low | TFS_tr_E9PNC7_E9PNC7_HUMAN:9:49_7cvq_A_1 | 7cvq | 9-49 | View model · PDB |
Model-summary evidence imported for this region.
| Rank | Template | Domain | N-tails | C-tails | Chains | Identity / similarity | Coverage | Model file |
|---|---|---|---|---|---|---|---|---|
| 1 | 1jfi | 3:55 | 10 | 55 | P:A · DNA:D,E | 100.0% / 100.0% | 73 | View · PDB TFS_tr_E9PNC7_E9PNC7_HUMAN:10:55_1jfi_A_1 |
| 2 | 4wzs | 3:55 | 13 | 50 | P:A · DNA:E,F | 50.0% / 84.2% | 57 | View · PDB TFS_tr_E9PNC7_E9PNC7_HUMAN:13:50_4wzs_A_1 |
| 3 | 6r2v | 3:55 | 9 | 49 | P:C · DNA:I,J | 46.3% / 68.3% | 43 | View · PDB TFS_tr_E9PNC7_E9PNC7_HUMAN:9:49_6r2v_C_1 |
| 4 | 7cvq | 3:55 | 9 | 49 | P:A · DNA:D,E | 46.3% / 68.3% | 32 | View · PDB TFS_tr_E9PNC7_E9PNC7_HUMAN:9:49_7cvq_A_1 |
| 5 | 7c9o | 3:55 | 11 | 49 | P:C · DNA:D,E | 46.2% / 71.8% | 48 | View · PDB TFS_tr_E9PNC7_E9PNC7_HUMAN:11:49_7c9o_C_1 |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 10-55 | PF00808 | Histone-like transcription factor (CBF/NF-Y) and archaeal histone | overlaps 9-55 |