ModCRE DB

Transcription factor

E9PQX9 - DRAP1

DR1 associated protein 1

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 185 aa

6 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE6
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_E9PQX9_E9PQX9_HUMAN:1:55_1jfi_A_1 ModCRE Homology model CCTACAAAAAGCCCGCT Region 1-55 · 1 3D model Open · Scan
TFS_tr_E9PQX9_E9PQX9_HUMAN:1:66_4wzs_A_1 ModCRE Homology model GCCCAGC Region 1-66 · 1 3D model Open · Scan
TFS_tr_E9PQX9_E9PQX9_HUMAN:1:67_4awl_C_1 ModCRE Homology model AGCAAAATTTAAATAAATTAATATA Region 1-67 · 1 3D model Open · Scan
TFS_tr_E9PQX9_E9PQX9_HUMAN:1:67_4g92_C_1 ModCRE Homology model AGCGCAACTTTAAAAATTTTAAC Region 1-67 · 1 3D model Open · Scan
TFS_tr_E9PQX9_E9PQX9_HUMAN:1:67_6r2v_C_1 ModCRE Homology model GTAAGTACCCCAAGCCATTTATA Region 1-67 · 1 3D model Open · Scan
TFS_tr_E9PQX9_E9PQX9_HUMAN:1:67_7cvq_A_1 ModCRE Homology model AACTTAAAACCTTAAAAATTTT Region 1-67 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 185 aa
1-67

Region 1-67 6 PWM

Residues
67 aa
Domains
PF00808 · Histone-like transcription factor (CBF/NF-Y) and archaeal histone
3D models
6 active PDBs · 5 summary rows
Templates
1JFI, 4AWL, 4G92, 4WZS, 6R2V, 7CVQ
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 5 summary rows
Region 1-676 models · 5 summary rows
Actions
Predicted = Low TFS_tr_E9PQX9_E9PQX9_HUMAN:1:55_1jfi_A_1 1jfi 1-55 View model · PDB
Predicted = Low TFS_tr_E9PQX9_E9PQX9_HUMAN:1:66_4wzs_A_1 4wzs 1-66 View model · PDB
Predicted = Low TFS_tr_E9PQX9_E9PQX9_HUMAN:1:67_4awl_C_1 4awl 1-67 View model · PDB
Predicted = Low TFS_tr_E9PQX9_E9PQX9_HUMAN:1:67_4g92_C_1 4g92 1-67 View model · PDB
Predicted = Low TFS_tr_E9PQX9_E9PQX9_HUMAN:1:67_6r2v_C_1 6r2v 1-67 View model · PDB
Predicted = Low TFS_tr_E9PQX9_E9PQX9_HUMAN:1:67_7cvq_A_1 7cvq 1-67 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 1jfi 1:67 1 55 P:A · DNA:D,E 94.5% / 94.5% 82 View · PDB TFS_tr_E9PQX9_E9PQX9_HUMAN:1:55_1jfi_A_1
2 4wzs 1:67 1 66 P:A · DNA:E,F 30.3% / 57.6% 86 View · PDB TFS_tr_E9PQX9_E9PQX9_HUMAN:1:66_4wzs_A_1
4 4awl 1:67 1 67 P:C · DNA:I,J 29.9% / 56.7% 83 View · PDB TFS_tr_E9PQX9_E9PQX9_HUMAN:1:67_4awl_C_1
3 6r2v 1:67 1 67 P:C · DNA:I,J 28.4% / 55.2% 70 View · PDB TFS_tr_E9PQX9_E9PQX9_HUMAN:1:67_6r2v_C_1
5 7cvq 1:67 1 67 P:A · DNA:D,E 28.4% / 55.2% 53 View · PDB TFS_tr_E9PQX9_E9PQX9_HUMAN:1:67_7cvq_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
1-54PF00808Histone-like transcription factor (CBF/NF-Y) and archaeal histoneoverlaps 1-67