Region 223-282 0 PWM
- Residues
- 60 aa
- Domains
- PF00046 · Homeodomain
- 3D models
- 1 active PDB
- Templates
- 1FJL
- Sources
- Structure model
Transcription factor
Paired box protein Pax-6 (Oculorhombin)
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 436 aa
Only entries with a generated matrix are shown here.
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M10806_2.00 | Known | CisBP | AATTTTCACGCATGAGTTCAC | Direct PWM | Open · Scan |
No generated PWM in this category.
No generated PWM in this category.
No generated PWM in this category.
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | DIMER_F1T0F8:223:282_1fjl_A_1 | 1fjl | 223-282 | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 4-142 | PF00292 | 'Paired box' domain | No overlap with loaded model regions |
| 226-281 | PF00046 | Homeodomain | overlaps 223-282 |