Region 151-261 0 PWM
- Residues
- 111 aa
- Domains
- PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13465 · Zinc-finger double domain
- 3D models
- 1 active PDB
- Templates
- 5EGB
- Sources
- Structure model
Transcription factor
F5H290 - ZNF7
Zinc finger protein 7
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 590 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known1
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M07598_2.00 | Known | CisBP | CTGACAATACCAAGTGTTGAC | Direct PWM | Open · Scan |
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)0
No generated PWM in this category.
ModCRE0
No generated PWM in this category.
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
590 aa
151-261
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 151-2611 model
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | TFS_F5H290:151:261_5egb_A_1 | 5egb | 151-261 | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 154-176 | PF00096 | Zinc finger, C2H2 type | overlaps 151-261 |
| 182-204 | PF00096 | Zinc finger, C2H2 type | overlaps 151-261 |
| 210-232 | PF00096 | Zinc finger, C2H2 type | overlaps 151-261 |
| 253-277 | PF13465 | Zinc-finger double domain | overlaps 151-261 |
| 373-395 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 401-423 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 429-451 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 457-479 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 485-507 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 538-560 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 566-588 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |