Transcription factor
Zinc finger protein interacting with ribonucleoprotein K
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 474 aa
Only entries with a generated matrix are shown here.
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M07633_2.00 | Known | CisBP | CTCTCGTTGTGCCTTTGCCAT | Direct PWM | Open · Scan |
No generated PWM in this category.
No generated PWM in this category.
No generated PWM in this category.
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | TFS_F5H435:198:472_5v3j_E_1 | 5v3j | 198-472 | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 13-54 | PF01352 | KRAB box | No overlap with loaded model regions |
| 227-252 | PF23561 | C2H2 zinc finger | overlaps 198-472 |
| 255-276 | PF00096 | Zinc finger, C2H2 type | overlaps 198-472 |
| 282-304 | PF00096 | Zinc finger, C2H2 type | overlaps 198-472 |
| 310-332 | PF00096 | Zinc finger, C2H2 type | overlaps 198-472 |
| 338-360 | PF00096 | Zinc finger, C2H2 type | overlaps 198-472 |
| 366-388 | PF00096 | Zinc finger, C2H2 type | overlaps 198-472 |
| 394-416 | PF00096 | Zinc finger, C2H2 type | overlaps 198-472 |
| 422-444 | PF00096 | Zinc finger, C2H2 type | overlaps 198-472 |