ModCRE DB

Transcription factor

F5H6A5 - ZNF875

Zinc finger protein 875

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 386 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M07662_2.00 Known CisBP CCTGTGTCCTCCCTGGTCCCC Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 386 aa
109-385

Region 109-385 0 PWM

Residues
277 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5WJQ
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 109-3851 model
Actions
Predicted = Low TFS_F5H6A5:109:385_5wjq_D_1 5wjq 109-385 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
28-50PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
56-78PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
84-106PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
112-134PF00096Zinc finger, C2H2 typeoverlaps 109-385
140-162PF00096Zinc finger, C2H2 typeoverlaps 109-385
168-190PF00096Zinc finger, C2H2 typeoverlaps 109-385
196-218PF00096Zinc finger, C2H2 typeoverlaps 109-385
224-246PF00096Zinc finger, C2H2 typeoverlaps 109-385
252-274PF00096Zinc finger, C2H2 typeoverlaps 109-385
280-302PF00096Zinc finger, C2H2 typeoverlaps 109-385
306-328PF00096Zinc finger, C2H2 typeoverlaps 109-385
334-356PF00096Zinc finger, C2H2 typeoverlaps 109-385
362-384PF00096Zinc finger, C2H2 typeoverlaps 109-385