ModCRE DB

Transcription factor

F5H6H0 - HMGA2

High mobility group AT-hook 2

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 147 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M07693_2.00 NN 70+% CisBP CTCCTGTGTGTGCCTTGGCTG 86.9% identity Open · Scan
Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

AF3 model assignments
Validated exact-accession AF3 models stored in local staging. Confidence artifacts are indexed but not visualized yet.
1 active AF3 model
TypeModelResidues / fragmentInterfaceConfidence filesActions
AF3 full-length model F5H6H0_model.cif Full sequence PASS_NONEMPTY_PROTEIN_DNA_INTERFACE 3 indexed View model · mmCIF

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomain
26-36PF02178AT hook motif
46-58PF02178AT hook motif
74-84PF02178AT hook motif