Transcription factor

F6UGA0 - RFX3

Transcription factor RFX3 (Regulatory factor X 3)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 216 aa

12 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)5

Motif	Prediction	Source	DNA binding	Support	Actions
M03463_2.00	NN 70+%	CisBP	GGTTGCCATGGCAACG	89.6% identity	Open · Scan
MA0798.1	NN 70+%	JASPAR	CGTTGCCATGGCAACG	89.6% identity	Open · Scan
M02454_2.00	NN 70+%	CisBP	CGTTGCTAAG	79.7% identity	Open · Scan
M03963_2.00	NN 70+%	CisBP	GTTGCTAGGCAAC	74.2% identity	Open · Scan
M00709_2.00	NN 70+%	CisBP	GGTTGCTATG	70.3% identity	Open · Scan

Nearest Neighbor (70% - 40%)7

Motif	Prediction	Source	DNA binding	Support	Actions
M09366_2.00	NN 70-40%	CisBP	TCCCGTTGCCATGGCAACCGCC	64.0% identity	Open · Scan
MA0799.1	NN 70-40%	JASPAR	CGTTGCCATGGCAACG	63.4% identity	Open · Scan
M05721_2.00	NN 70-40%	CisBP	CGTTGCCATGGCAACG	61.8% identity	Open · Scan
MA0600.1	NN 70-40%	JASPAR	GTTGCCATGGCAACCGCGG	60.7% identity	Open · Scan
MA0509.1	NN 70-40%	JASPAR	GTTGCCATGGCAAC	51.9% identity	Open · Scan
M02451_2.00	NN 70-40%	CisBP	GTTGCCATGG	51.6% identity	Open · Scan
M02450_2.00	NN 70-40%	CisBP	CGTTGCTAAG	51.5% identity	Open · Scan

ModCRE0

No generated PWM in this category.

AF3 model assignments

Validated exact-accession AF3 models stored in local staging. Confidence artifacts are indexed but not visualized yet.

1 active AF3 model

Type	Model	Residues / fragment	Interface	Confidence files	Actions
AF3 full-length model	F6UGA0_model.cif	Full sequence	PASS_NONEMPTY_PROTEIN_DNA_INTERFACE	3 indexed	View model · mmCIF

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain
25-134	PF04589	RFX1 transcription activation region
157-216	PF02257	RFX DNA-binding domain