ModCRE DB

Transcription factor

F8VPL6 - IKZF4

IKAROS family zinc finger 4

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 540 aa

9 Generated PWM 8 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)1
MotifPredictionSourceDNA bindingSupportLogoActions
MA1508.1 NN 70-40% JASPAR GAAACAGGAAGT 52.6% identity Open · Scan
ModCRE8
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_tr_F8VPL6_F8VPL6_HUMAN:140:188_1llm_C_1 ModCRE Homology model CCGGCGCGCATA Region 140-188 · 1 3D model Open · Scan
DIMER_tr_F8VPL6_F8VPL6_HUMAN:171:223_1hwt_C_1 ModCRE Homology model CGCCGGGCCGGCCTTTTCC Region 171-223 · 1 3D model Open · Scan
DIMER_tr_F8VPL6_F8VPL6_HUMAN:179:223_2hap_D_1 ModCRE Homology model GAAATAAACCCAATGGG Region 179-223 · 1 3D model Open · Scan
TFS_tr_F8VPL6_F8VPL6_HUMAN:115:222_2i13_A_1 ModCRE Homology model AAGTAAGGCCTAAAGGGGCA Region 115-222 · 1 3D model Open · Scan
TFS_tr_F8VPL6_F8VPL6_HUMAN:115:223_5wjq_D_1 ModCRE Homology model AGGCCCCCTGTTTATTGG Region 115-223 · 1 3D model Open · Scan
TFS_tr_F8VPL6_F8VPL6_HUMAN:116:222_5egb_A_1 ModCRE Homology model CCCCCGTGGGGAGCCTTT Region 116-222 · 1 3D model Open · Scan
TFS_tr_F8VPL6_F8VPL6_HUMAN:116:222_5eh2_F_1 ModCRE Homology model CCCGCCGGGGGCCCCGGAA Region 116-222 · 1 3D model Open · Scan
TFS_tr_F8VPL6_F8VPL6_HUMAN:116:222_5ei9_E_1 ModCRE Homology model CCGGCGTGGGGGGCCCA Region 116-222 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 540 aa
115-223

Region 115-223 8 PWM

Residues
109 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
8 active PDBs · 8 summary rows
Templates
1HWT, 1LLM, 2HAP, 2I13, 5EGB, 5EH2, 5EI9, 5WJQ
Sources
Predicted = Low
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
8 active PDB models 8 summary rows
Region 115-2238 models · 8 summary rows
Actions
Predicted = Low DIMER_tr_F8VPL6_F8VPL6_HUMAN:140:188_1llm_C_1 1llm 140-188 View model · PDB
Predicted = Low DIMER_tr_F8VPL6_F8VPL6_HUMAN:171:223_1hwt_C_1 1hwt 171-223 View model · PDB
Predicted = Low DIMER_tr_F8VPL6_F8VPL6_HUMAN:179:223_2hap_D_1 2hap 179-223 View model · PDB
Predicted = Low TFS_tr_F8VPL6_F8VPL6_HUMAN:115:222_2i13_A_1 2i13 115-222 View model · PDB
Predicted = Low TFS_tr_F8VPL6_F8VPL6_HUMAN:115:223_5wjq_D_1 5wjq 115-223 View model · PDB
Predicted = Low TFS_tr_F8VPL6_F8VPL6_HUMAN:116:222_5egb_A_1 5egb 116-222 View model · PDB
Predicted = Low TFS_tr_F8VPL6_F8VPL6_HUMAN:116:222_5eh2_F_1 5eh2 116-222 View model · PDB
Predicted = Low TFS_tr_F8VPL6_F8VPL6_HUMAN:116:222_5ei9_E_1 5ei9 116-222 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 2i13 113:230 115 222 P:A · DNA:C,D 43.5% / 58.3% 68 View · PDB TFS_tr_F8VPL6_F8VPL6_HUMAN:115:222_2i13_A_1
2 5ei9 113:230 116 222 P:E · DNA:A,B 41.1% / 55.1% 91 View · PDB TFS_tr_F8VPL6_F8VPL6_HUMAN:116:222_5ei9_E_1
3 5egb 113:230 116 222 P:A · DNA:C,D 41.1% / 55.1% 91 View · PDB TFS_tr_F8VPL6_F8VPL6_HUMAN:116:222_5egb_A_1
4 5eh2 113:230 116 222 P:F · DNA:C,D 41.1% / 55.1% 93 View · PDB TFS_tr_F8VPL6_F8VPL6_HUMAN:116:222_5eh2_F_1
5 5wjq 113:230 115 223 P:D · DNA:A,B 40.4% / 58.7% 36 View · PDB TFS_tr_F8VPL6_F8VPL6_HUMAN:115:223_5wjq_D_1
1 1llm 113:230 140,140 188,188 P:C,D · DNA:A,B 38.8% / 53.1% 56,57 View · PDB DIMER_tr_F8VPL6_F8VPL6_HUMAN:140:188_1llm_C_1
2 2hap 113:230 179,179 223,223 P:C,D · DNA:A,B 24.4% / 46.7% 59,60 View · PDB DIMER_tr_F8VPL6_F8VPL6_HUMAN:179:223_2hap_D_1
3 1hwt 113:230 171,171 223,223 P:C,D · DNA:A,B 22.6% / 43.4% 75,71 View · PDB DIMER_tr_F8VPL6_F8VPL6_HUMAN:171:223_1hwt_C_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
142-164PF00096Zinc finger, C2H2 typeoverlaps 115-223
170-192PF00096Zinc finger, C2H2 typeoverlaps 115-223
203-226PF00096Zinc finger, C2H2 typeoverlaps 115-223