ModCRE DB

Transcription factor

H0Y5I5 - ZNF687

Zinc finger protein 687

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 706 aa

6 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE6
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_tr_H0Y5I5_H0Y5I5_HUMAN:568:619_1llm_D_1 ModCRE Homology model CCCGCCGGCGGG Region 568-619 · 1 3D model Open · Scan
TFS_tr_H0Y5I5_H0Y5I5_HUMAN:276:413_2i13_A_1 ModCRE Homology model CTGGATCTTAAGTGAGGGCAA Region 276-413 · 1 3D model Open · Scan
TFS_tr_H0Y5I5_H0Y5I5_HUMAN:310:484_5und_A_1 ModCRE Homology model GACGCAACATTATCTCTTCCCCTCC Region 310-484 · 1 3D model Open · Scan
TFS_tr_H0Y5I5_H0Y5I5_HUMAN:310:490_8ssq_A_1 ModCRE Homology model GCAGGGGGACGAGAGCCAAATTTAAAA Region 310-490 · 1 3D model Open · Scan
TFS_tr_H0Y5I5_H0Y5I5_HUMAN:310:490_8ssr_A_1 ModCRE Homology model GGCCAAGGAGGAACGCCAAATTAAAA Region 310-490 · 1 3D model Open · Scan
TFS_tr_H0Y5I5_H0Y5I5_HUMAN:338:482_5yel_B_1 ModCRE Homology model TTTATAAGTACTAACACAAATGTTA Region 338-482 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 706 aa
276-490
568-619

Region 276-490 5 PWM

Residues
215 aa
Domains
No overlapping PFAM annotation recorded
3D models
5 active PDBs · 5 summary rows
Templates
2I13, 5UND, 5YEL, 8SSQ, 8SSR
Sources
Predicted = Low
Scan this region Show models

Region 568-619 1 PWM

Residues
52 aa
Domains
PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB · 1 summary row
Templates
1LLM
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 276-4905 models · 5 summary rows
Actions
Predicted = Low TFS_tr_H0Y5I5_H0Y5I5_HUMAN:276:413_2i13_A_1 2i13 276-413 View model · PDB
Predicted = Low TFS_tr_H0Y5I5_H0Y5I5_HUMAN:310:484_5und_A_1 5und 310-484 View model · PDB
Predicted = Low TFS_tr_H0Y5I5_H0Y5I5_HUMAN:310:490_8ssq_A_1 8ssq 310-490 View model · PDB
Predicted = Low TFS_tr_H0Y5I5_H0Y5I5_HUMAN:310:490_8ssr_A_1 8ssr 310-490 View model · PDB
Predicted = Low TFS_tr_H0Y5I5_H0Y5I5_HUMAN:338:482_5yel_B_1 5yel 338-482 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 2i13 274:490 276 413 P:A · DNA:C,D 29.7% / 43.5% 86 View · PDB TFS_tr_H0Y5I5_H0Y5I5_HUMAN:276:413_2i13_A_1
2 5und 274:490 310 484 P:A · DNA:C,D 28.8% / 34.5% 95 View · PDB TFS_tr_H0Y5I5_H0Y5I5_HUMAN:310:484_5und_A_1
3 5yel 274:490 338 482 P:B · DNA:C,D 27.2% / 41.5% 79 View · PDB TFS_tr_H0Y5I5_H0Y5I5_HUMAN:338:482_5yel_B_1
4 8ssr 274:490 310 490 P:A · DNA:B,C 24.6% / 38.3% 65 View · PDB TFS_tr_H0Y5I5_H0Y5I5_HUMAN:310:490_8ssr_A_1
5 8ssq 274:490 310 490 P:A · DNA:B,C 24.6% / 38.3% 65 View · PDB TFS_tr_H0Y5I5_H0Y5I5_HUMAN:310:490_8ssq_A_1
Region 568-6191 model · 1 summary row
Actions
Predicted = Low DIMER_tr_H0Y5I5_H0Y5I5_HUMAN:568:619_1llm_D_1 1llm 568-619 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 1llm 274:490 568,568 619,619 P:C,D · DNA:A,B 28.8% / 44.2% 57,58 View · PDB DIMER_tr_H0Y5I5_H0Y5I5_HUMAN:568:619_1llm_D_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
158-202PF25412ZNF592-like C2H2 zinc fingerNo overlap with loaded model regions
596-619PF00096Zinc finger, C2H2 typeoverlaps 568-619