ModCRE DB

Transcription factor

H0Y9S1 - PRDM5

PR/SET domain 5

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 145 aa

5 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE5
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_H0Y9S1_H0Y9S1_HUMAN:11:127_2i13_A_1 ModCRE Homology model AGACCACCGACGCCGCGGGG Region 11-127 · 1 3D model Open · Scan
TFS_tr_H0Y9S1_H0Y9S1_HUMAN:11:127_5eh2_F_1 ModCRE Homology model CCCGCGTGGGGGCCCCCGG Region 11-127 · 1 3D model Open · Scan
TFS_tr_H0Y9S1_H0Y9S1_HUMAN:29:131_6b0o_A_1 ModCRE Homology model GGGGGGTCCCGC Region 29-131 · 1 3D model Open · Scan
TFS_tr_H0Y9S1_H0Y9S1_HUMAN:8:127_5egb_A_1 ModCRE Homology model CCCGGGGGGGGGCCCCGG Region 8-127 · 1 3D model Open · Scan
TFS_tr_H0Y9S1_H0Y9S1_HUMAN:8:127_5ei9_E_1 ModCRE Homology model CCGGGCCCCGCCCCCCC Region 8-127 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 145 aa
8-131

Region 8-131 5 PWM

Residues
124 aa
Domains
PF13912 · C2H2-type zinc finger PF00096 · Zinc finger, C2H2 type PF12874 · Zinc-finger of C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 2I13, 5EGB, 5EH2, 5EI9, 6B0O
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 8-1316 models · 6 summary rows
Actions
Predicted = Low DIMER_tr_H0Y9S1_H0Y9S1_HUMAN:76:131_1llm_D_1 1llm 76-131 View model · PDB
Predicted = Low TFS_tr_H0Y9S1_H0Y9S1_HUMAN:11:127_2i13_A_1 2i13 11-127 View model · PDB
Predicted = Low TFS_tr_H0Y9S1_H0Y9S1_HUMAN:11:127_5eh2_F_1 5eh2 11-127 View model · PDB
Predicted = Low TFS_tr_H0Y9S1_H0Y9S1_HUMAN:29:131_6b0o_A_1 6b0o 29-131 View model · PDB
Predicted = Low TFS_tr_H0Y9S1_H0Y9S1_HUMAN:8:127_5egb_A_1 5egb 8-127 View model · PDB
Predicted = Low TFS_tr_H0Y9S1_H0Y9S1_HUMAN:8:127_5ei9_E_1 5ei9 8-127 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 1llm 8:133 76,76 131,131 P:C,D · DNA:A,B 33.9% / 50.0% 62,63 View · PDB DIMER_tr_H0Y9S1_H0Y9S1_HUMAN:76:131_1llm_D_1
5 6b0o 8:133 29 131 P:A · DNA:B,C 33.3% / 47.6% 79 View · PDB TFS_tr_H0Y9S1_H0Y9S1_HUMAN:29:131_6b0o_A_1
1 2i13 8:133 11 127 P:A · DNA:C,D 33.3% / 45.3% 68 View · PDB TFS_tr_H0Y9S1_H0Y9S1_HUMAN:11:127_2i13_A_1
2 5eh2 8:133 11 127 P:F · DNA:C,D 31.6% / 46.2% 95 View · PDB TFS_tr_H0Y9S1_H0Y9S1_HUMAN:11:127_5eh2_F_1
3 5ei9 8:133 8 127 P:E · DNA:A,B 30.8% / 46.7% 96 View · PDB TFS_tr_H0Y9S1_H0Y9S1_HUMAN:8:127_5ei9_E_1
4 5egb 8:133 8 127 P:A · DNA:C,D 30.8% / 46.7% 96 View · PDB TFS_tr_H0Y9S1_H0Y9S1_HUMAN:8:127_5egb_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
11-36PF13912C2H2-type zinc fingeroverlaps 8-131
43-62PF00096Zinc finger, C2H2 typeoverlaps 8-131
78-97PF12874Zinc-finger of C2H2 typeoverlaps 8-131
106-131PF00096Zinc finger, C2H2 typeoverlaps 8-131