ModCRE DB

Transcription factor

H0YA13 - PRDM16

PR/SET domain 16

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 1084 aa

10 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)5
MotifPredictionSourceDNA bindingSupportLogoActions
M02667_2.00 NN 70-40% CisBP TATTATCTTATCTT 58.0% identity Open · Scan
M00613_2.00 NN 70-40% CisBP TTTTTTTC 50.6% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 50.0% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 50.0% identity Open · Scan
M01442_2.00 NN 70-40% CisBP ACCCCACATT 50.0% identity Open · Scan
ModCRE5
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_H0YA13_H0YA13_HUMAN:115:225_5ei9_E_1 ModCRE Homology model TCCGAGGGGGGGCCGCCC Region 115-225 · 1 3D model Open · Scan
TFS_tr_H0YA13_H0YA13_HUMAN:91:256_5v3j_E_1 ModCRE Homology model AGCCGCTGGGGGTGGGTGTCAG Region 91-256 · 1 3D model Open · Scan
TFS_tr_H0YA13_H0YA13_HUMAN:91:256_5v3m_C_1 ModCRE Homology model AGGGGGGCTCCCCCGGGGGCTG Region 91-256 · 1 3D model Open · Scan
TFS_tr_H0YA13_H0YA13_HUMAN:91:256_5wjq_D_1 ModCRE Homology model GCCCGGGGGCCCGGGGGGGCCT Region 91-256 · 1 3D model Open · Scan
TFS_tr_H0YA13_H0YA13_HUMAN:99:252_2i13_A_1 ModCRE Homology model TGGCGTAAGGAAAGCTCTAGA Region 99-252 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1084 aa
91-256
759-805

Region 91-256 5 PWM

Residues
166 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
5 active PDBs · 5 summary rows
Templates
2I13, 5EI9, 5V3J, 5V3M, 5WJQ
Sources
Predicted = Low
Scan this region Show models

Region 759-805 0 PWM

Residues
47 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB · 1 summary row
Templates
1LLM
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 91-2565 models · 5 summary rows
Actions
Predicted = Low TFS_tr_H0YA13_H0YA13_HUMAN:115:225_5ei9_E_1 5ei9 115-225 View model · PDB
Predicted = Low TFS_tr_H0YA13_H0YA13_HUMAN:91:256_5v3j_E_1 5v3j 91-256 View model · PDB
Predicted = Low TFS_tr_H0YA13_H0YA13_HUMAN:91:256_5v3m_C_1 5v3m 91-256 View model · PDB
Predicted = Low TFS_tr_H0YA13_H0YA13_HUMAN:91:256_5wjq_D_1 5wjq 91-256 View model · PDB
Predicted = Low TFS_tr_H0YA13_H0YA13_HUMAN:99:252_2i13_A_1 2i13 99-252 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 5v3m 88:256 91 256 P:C · DNA:A,B 38.0% / 59.6% 59 View · PDB TFS_tr_H0YA13_H0YA13_HUMAN:91:256_5v3m_C_1
2 5v3j 88:256 91 256 P:E · DNA:A,B 38.0% / 59.6% 59 View · PDB TFS_tr_H0YA13_H0YA13_HUMAN:91:256_5v3j_E_1
3 5wjq 88:256 91 256 P:D · DNA:A,B 38.0% / 59.6% 58 View · PDB TFS_tr_H0YA13_H0YA13_HUMAN:91:256_5wjq_D_1
5 5ei9 88:256 115 225 P:E · DNA:A,B 37.8% / 59.5% 99 View · PDB TFS_tr_H0YA13_H0YA13_HUMAN:115:225_5ei9_E_1
4 2i13 88:256 99 252 P:A · DNA:C,D 37.7% / 57.8% 98 View · PDB TFS_tr_H0YA13_H0YA13_HUMAN:99:252_2i13_A_1
Region 759-8051 model · 1 summary row
Actions
Predicted = Low DIMER_tr_H0YA13_H0YA13_HUMAN:759:805_1llm_C_1 1llm 759-805 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 1llm 88:256 759,759 805,805 P:C,D · DNA:A,B 48.9% / 66.0% 54,55 View · PDB DIMER_tr_H0YA13_H0YA13_HUMAN:759:805_1llm_C_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
39-59PF13912C2H2-type zinc fingerNo overlap with loaded model regions
90-112PF00096Zinc finger, C2H2 typeoverlaps 91-256
118-140PF00096Zinc finger, C2H2 typeoverlaps 91-256
146-169PF00096Zinc finger, C2H2 typeoverlaps 91-256
175-197PF00096Zinc finger, C2H2 typeoverlaps 91-256
203-225PF00096Zinc finger, C2H2 typeoverlaps 91-256
233-252PF00096Zinc finger, C2H2 typeoverlaps 91-256
759-781PF00096Zinc finger, C2H2 typeoverlaps 759-805
787-810PF00096Zinc finger, C2H2 typeoverlaps 759-805
816-838PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions