Transcription factor

H0YBT7 - HSF4

Heat shock transcription factor 4

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 185 aa

4 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
MA0771.1	NN 70+%	JASPAR	TTCTAGAACGTTC	89.8% identity		Open · Scan

Nearest Neighbor (70% - 40%)3

Motif	Prediction	Source	DNA binding	Support	Actions
M01257_2.00	NN 70-40%	CisBP	AATCTTCCAT	68.4% identity	Open · Scan
M08586_2.00	NN 70-40%	CisBP	TTTTATTTCTTCTATTCTCTA	58.5% identity	Open · Scan
MA0486.1	NN 70-40%	JASPAR	CTTCTAGAAGGTTCT	53.0% identity	Open · Scan

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 185 aa

1-78

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 1-781 model

				Actions
Predicted = Low	TFS_H0YBT7:1:78_5d5x_B_1	5d5x	1-78	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
1-78	PF00447	HSF-type DNA-binding	overlaps 1-78