ModCRE DB

Transcription factor

H0YED9 - WT1

WT1 transcription factor

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 275 aa

26 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)3
MotifPredictionSourceDNA bindingSupportLogoActions
MA1627.1 NN 70+% JASPAR CCCCTCCCCCACAC 86.4% identity Open · Scan
M00249_2.00 NN 70+% CisBP ACTCCCCCGCA 84.5% identity Open · Scan
M08968_2.00 NN 70+% CisBP CCCCCCCTCCTCCCCCGCCC 80.5% identity Open · Scan
Nearest Neighbor (70% - 40%)23
MotifPredictionSourceDNA bindingSupportLogoActions
M08525_2.00 NN 70-40% CisBP CCCCGCA 55.1% identity Open · Scan
M00777_2.00 NN 70-40% CisBP ACCGTTAT 55.0% identity Open · Scan
MA0732.1 NN 70-40% JASPAR CTACGCCCACGCACT 55.0% identity Open · Scan
M01529_2.00 NN 70-40% CisBP CCCCGCATT 53.7% identity Open · Scan
M00632_2.00 NN 70-40% CisBP ACACGCCCCT 53.5% identity Open · Scan
M01192_2.00 NN 70-40% CisBP CCCCCTGA 53.1% identity Open · Scan
M00134_2.00 NN 70-40% CisBP GCCACGCCCA 52.9% identity Open · Scan
M04555_2.00 NN 70-40% CisBP GCCACGCCCCCGCCACGCCCAC 52.8% identity Open · Scan
MA1512.1 NN 70-40% JASPAR GCCACGCCCAC 52.8% identity Open · Scan
M00617_2.00 NN 70-40% CisBP CCACGCCCA 52.3% identity Open · Scan
MA1513.1 NN 70-40% JASPAR GCCCCGCCCCC 52.3% identity Open · Scan
M01432_2.00 NN 70-40% CisBP GACGCCAC 52.0% identity Open · Scan
M01439_2.00 NN 70-40% CisBP TTACGCCACA 52.0% identity Open · Scan
M06169_2.00 NN 70-40% CisBP GCCACGCCCAAC 51.7% identity Open · Scan
M06072_2.00 NN 70-40% CisBP CCACGCCCACGCAC 51.5% identity Open · Scan
M09515_2.00 NN 70-40% CisBP CCCGCCCACGCA 51.5% identity Open · Scan
MA0472.1 NN 70-40% JASPAR CCCCCGCCCACGCAC 51.5% identity Open · Scan
MA0472.2 NN 70-40% JASPAR ACGCCCACGCA 51.5% identity Open · Scan
M03682_2.00 NN 70-40% CisBP ACGCCACGCCCAGT 51.1% identity Open · Scan
MA0733.1 NN 70-40% JASPAR TTACGCCCACGCATTT 51.1% identity Open · Scan
MA0747.1 NN 70-40% JASPAR GCCACGCCCACT 51.1% identity Open · Scan
MA1564.1 NN 70-40% JASPAR GCCACGCCCCCC 51.1% identity Open · Scan
MA0740.1 NN 70-40% JASPAR GGCCACGCCCCCTT 50.5% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 275 aa
176-266

Region 176-266 0 PWM

Residues
91 aa
Domains
PF02165 · Wilm's tumour protein PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
1P47
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 176-2661 model
Actions
Predicted = Low TFS_H0YED9:176:266_1p47_A_1 1p47 176-266 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
3-113PF02165Wilm's tumour proteinNo overlap with loaded model regions
121-177PF02165Wilm's tumour proteinoverlaps 176-266
209-231PF00096Zinc finger, C2H2 typeoverlaps 176-266
240-264PF00096Zinc finger, C2H2 typeoverlaps 176-266