Transcription factor

H0YKL0 - HMG20A

High mobility group 20A

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 118 aa

7 Generated PWM 18 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M02487_2.00	NN 70-40%	CisBP	TTATTATATAT	53.9% identity		Open · Scan

ModCRE6

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
h0ykl0.af3.0	ModCRE	AlphaFold3 model	CGGGCCCGCGGGGGGGGCCCCT	AlphaFold3 model · ModCRE PWM		Open · Scan
h0ykl0.af3.1	ModCRE	AlphaFold3 model	AAAGACCGGGGAGGAGCCCCGAG	AlphaFold3 model · ModCRE PWM		Open · Scan
h0ykl0.af3.2	ModCRE	AlphaFold3 model	CGGGCCCGCGGGGGGGGCCCCT	AlphaFold3 model · ModCRE PWM		Open · Scan
h0ykl0.af3.3	ModCRE	AlphaFold3 model	CGGGCCTCGGGAGAGACCCAGG	AlphaFold3 model · ModCRE PWM		Open · Scan
h0ykl0.af3.4	ModCRE	AlphaFold3 model	CCCACAGTGTGTGAGACCCAGG	AlphaFold3 model · ModCRE PWM		Open · Scan
h0ykl0.af3.5	ModCRE	AlphaFold3 model	CCGGGGTCACCGAGGGCGAGG	AlphaFold3 model · ModCRE PWM		Open · Scan

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

18 active PDB models

Source	Model	Template	Residues modeled	Actions
Predicted = Low	h0ykl0.af3.0	-	Full sequence	View model · PDB
Predicted = Low	h0ykl0.af3.1	-	Full sequence	View model · PDB
Predicted = Low	h0ykl0.af3.2	-	Full sequence	View model · PDB
Predicted = Low	h0ykl0.af3.3	-	Full sequence	View model · PDB
Predicted = Low	h0ykl0.af3.4	-	Full sequence	View model · PDB
Predicted = Low	h0ykl0.af3.5	-	Full sequence	View model · PDB
Predicted = Low	h0ykl0_dimer.af3.0	-	Full sequence	View model · PDB
Predicted = Low	h0ykl0_dimer.af3.1	-	Full sequence	View model · PDB
Predicted = Low	h0ykl0_dimer.af3.2	-	Full sequence	View model · PDB
Predicted = Low	h0ykl0_dimer.af3.3	-	Full sequence	View model · PDB
Predicted = Low	h0ykl0_dimer.af3.4	-	Full sequence	View model · PDB
Predicted = Low	h0ykl0_dimer.af3.5	-	Full sequence	View model · PDB
Predicted = Low	h0ykl0_monomer.af3.0	-	Full sequence	View model · PDB
Predicted = Low	h0ykl0_monomer.af3.1	-	Full sequence	View model · PDB
Predicted = Low	h0ykl0_monomer.af3.2	-	Full sequence	View model · PDB
Predicted = Low	h0ykl0_monomer.af3.3	-	Full sequence	View model · PDB
Predicted = Low	h0ykl0_monomer.af3.4	-	Full sequence	View model · PDB
Predicted = Low	h0ykl0_monomer.af3.5	-	Full sequence	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Imported domain tags14

Atg14Bcr-Abl_OligoDMPK_coilDUF972DivICFib_alphaFilamentGASHALZIncATMF_DNA_bdTrans_reg_CTranslinbZIP_2