ModCRE DB

Transcription factor

H0YLZ7 - ZNF710

Zinc finger protein 710

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 387 aa

5 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M08908_2.00 NN 70-40% CisBP GCTGCTGCTTCTGCTG 50.0% identity Open · Scan
ModCRE4
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_H0YLZ7_H0YLZ7_HUMAN:152:303_2i13_A_1 ModCRE Homology model GCGACTAGCCAGCTTTAAATT Region 152-303 · 1 3D model Open · Scan
TFS_tr_H0YLZ7_H0YLZ7_HUMAN:29:304_5wjq_D_1 ModCRE Homology model GGCGGCCCCAAACCCCGCCCCCCCCGGG Region 29-304 · 1 3D model Open · Scan
TFS_tr_H0YLZ7_H0YLZ7_HUMAN:30:304_5v3j_E_1 ModCRE Homology model GCAGGGGGCGCCTTTACCCTCTCCG Region 30-304 · 1 3D model Open · Scan
TFS_tr_H0YLZ7_H0YLZ7_HUMAN:30:304_5v3m_C_1 ModCRE Homology model CCCCCCGGTTTAACCATCCCCTAAGG Region 30-304 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 387 aa
3-306

Region 3-306 4 PWM

Residues
304 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13912 · C2H2-type zinc finger PF13894 · C2H2-type zinc finger
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 2I13, 5V3J, 5V3M, 5WJQ, 7W1M
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 3-3066 models · 6 summary rows
Actions
Predicted = Low DIMER_tr_H0YLZ7_H0YLZ7_HUMAN:252:306_1llm_D_1 1llm 252-306 View model · PDB
Predicted = Low TFS_tr_H0YLZ7_H0YLZ7_HUMAN:152:303_2i13_A_1 2i13 152-303 View model · PDB
Predicted = Low TFS_tr_H0YLZ7_H0YLZ7_HUMAN:29:304_5wjq_D_1 5wjq 29-304 View model · PDB
Predicted = Low TFS_tr_H0YLZ7_H0YLZ7_HUMAN:30:304_5v3j_E_1 5v3j 30-304 View model · PDB
Predicted = Low TFS_tr_H0YLZ7_H0YLZ7_HUMAN:30:304_5v3m_C_1 5v3m 30-304 View model · PDB
Predicted = Low TFS_tr_H0YLZ7_H0YLZ7_HUMAN:3:301_7w1m_H_1 7w1m 3-301 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
5 2i13 3:306 152 303 P:A · DNA:C,D 40.1% / 53.3% 98 View · PDB TFS_tr_H0YLZ7_H0YLZ7_HUMAN:152:303_2i13_A_1
1 5v3m 3:306 30 304 P:C · DNA:A,B 38.9% / 51.3% 99 View · PDB TFS_tr_H0YLZ7_H0YLZ7_HUMAN:30:304_5v3m_C_1
2 5v3j 3:306 30 304 P:E · DNA:A,B 38.9% / 51.3% 99 View · PDB TFS_tr_H0YLZ7_H0YLZ7_HUMAN:30:304_5v3j_E_1
1 1llm 3:306 252,252 306,306 P:C,D · DNA:A,B 38.2% / 58.2% 63,64 View · PDB DIMER_tr_H0YLZ7_H0YLZ7_HUMAN:252:306_1llm_D_1
3 5wjq 3:306 29 304 P:D · DNA:A,B 36.6% / 51.4% 98 View · PDB TFS_tr_H0YLZ7_H0YLZ7_HUMAN:29:304_5wjq_D_1
4 7w1m 3:306 3 301 P:H · DNA:F,G 29.2% / 43.8% 92 View · PDB TFS_tr_H0YLZ7_H0YLZ7_HUMAN:3:301_7w1m_H_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
4-25PF00096Zinc finger, C2H2 typeoverlaps 3-306
31-53PF00096Zinc finger, C2H2 typeoverlaps 3-306
59-81PF00096Zinc finger, C2H2 typeoverlaps 3-306
87-109PF00096Zinc finger, C2H2 typeoverlaps 3-306
115-137PF00096Zinc finger, C2H2 typeoverlaps 3-306
143-165PF00096Zinc finger, C2H2 typeoverlaps 3-306
171-193PF00096Zinc finger, C2H2 typeoverlaps 3-306
199-221PF00096Zinc finger, C2H2 typeoverlaps 3-306
227-249PF00096Zinc finger, C2H2 typeoverlaps 3-306
255-274PF13912C2H2-type zinc fingeroverlaps 3-306
283-306PF13894C2H2-type zinc fingeroverlaps 3-306