Region 42-217 0 PWM
- Residues
- 176 aa
- Domains
- PF00907 · T-box
- 3D models
- 1 active PDB
- Templates
- 4S0H
- Sources
- Structure model
Transcription factor
H0YM91 - TBXT
T-box transcription factor T (Brachyury protein) (Protein T)
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 243 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known1
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M09427_2.00 | Known | CisBP | TTAGCAGGGAGGTGTGAAAT | Direct PWM | Open · Scan |
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)0
No generated PWM in this category.
ModCRE0
No generated PWM in this category.
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
243 aa
42-217
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 42-2171 model
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | DIMER_H0YM91:42:217_4s0h_E_1 | 4s0h | 42-217 | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 44-218 | PF00907 | T-box | overlaps 42-217 |