ModCRE DB

Transcription factor

H0YN23 - TSHZ1

Teashirt zinc finger homeobox 1

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 276 aa

4 Generated PWM 4 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE4
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_H0YN23_H0YN23_HUMAN:185:271_2i13_A_1 ModCRE Homology model TGGGATGAGGGTTTAAAAAC Region 185-271 · 1 3D model Open · Scan
TFS_tr_H0YN23_H0YN23_HUMAN:197:224_5v3j_E_1 ModCRE Homology model AGACGCAGGGGA Region 197-224 · 1 3D model Open · Scan
TFS_tr_H0YN23_H0YN23_HUMAN:197:224_5v3m_C_1 ModCRE Homology model AGATTCCGGTGGA Region 197-224 · 1 3D model Open · Scan
TFS_tr_H0YN23_H0YN23_HUMAN:197:224_5wjq_D_1 ModCRE Homology model CCAAGCAGAGTAA Region 197-224 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 276 aa
185-271

Region 185-271 4 PWM

Residues
87 aa
Domains
No overlapping PFAM annotation recorded
3D models
4 active PDBs · 4 summary rows
Templates
2I13, 5V3J, 5V3M, 5WJQ
Sources
Predicted = Low
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
4 active PDB models 4 summary rows
Region 185-2714 models · 4 summary rows
Actions
Predicted = Low TFS_tr_H0YN23_H0YN23_HUMAN:185:271_2i13_A_1 2i13 185-271 View model · PDB
Predicted = Low TFS_tr_H0YN23_H0YN23_HUMAN:197:224_5v3j_E_1 5v3j 197-224 View model · PDB
Predicted = Low TFS_tr_H0YN23_H0YN23_HUMAN:197:224_5v3m_C_1 5v3m 197-224 View model · PDB
Predicted = Low TFS_tr_H0YN23_H0YN23_HUMAN:197:224_5wjq_D_1 5wjq 197-224 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 5v3m 197:224 197 224 P:C · DNA:A,B 44.8% / 58.6% 10 View · PDB TFS_tr_H0YN23_H0YN23_HUMAN:197:224_5v3m_C_1
2 5v3j 197:224 197 224 P:E · DNA:A,B 44.8% / 58.6% 10 View · PDB TFS_tr_H0YN23_H0YN23_HUMAN:197:224_5v3j_E_1
3 5wjq 197:224 197 224 P:D · DNA:A,B 44.8% / 58.6% 10 View · PDB TFS_tr_H0YN23_H0YN23_HUMAN:197:224_5wjq_D_1
4 2i13 197:224 185 271 P:A · DNA:C,D 25.3% / 40.2% 54 View · PDB TFS_tr_H0YN23_H0YN23_HUMAN:185:271_2i13_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Imported domain tags10
CxxC_CxxC_SSSSDUF1180PyrI_Czf-C2H2zf-C2H2_2zf-C2H2_4zf-C2H2_6zf-H2C2_2zinc_ribbon_4zinc_ribbon_5