Transcription factor

H0YNG1 - POU2F2

POU domain, class 2, transcription factor 1 (NF-A1) (Octamer-binding protein 1) (Octamer-binding transcription factor 1)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 198 aa

3 Generated PWM

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)2

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M00548_2.00	NN 70+%	CisBP	GATAATTAA	70.8% identity		Open · Scan
M10829_2.00	NN 70+%	CisBP	ATATAATTATGCAAATTAAAAGA	70.8% identity		Open · Scan

Nearest Neighbor (70% - 40%)1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
MA0785.1	NN 70-40%	JASPAR	AATATGCAAATT	66.6% identity		Open · Scan

ModCRE0

No generated PWM in this category.

PWM available; no validated DNA-bound structure

POU2F2 accession. POU transcription factors require a bipartite DNA-binding domain consisting of the POU-specific domain and homeodomain. This accession does not demonstrate both complete components; only 39.10% of the canonical combined POU DNA-binding region aligns.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain
68-178	PF19536	POU domain, class 2, transcription factor 1 C-terminal