Transcription factor

H3BRS1 - NFATC3

Nuclear factor of activated T cells 3

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 1060 aa

8 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)2

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M05693_2.00	NN 70+%	CisBP	ATTTTCCATT	99.7% identity		Open · Scan
MA0625.1	NN 70+%	JASPAR	ATTTTCCATT	99.7% identity		Open · Scan

Nearest Neighbor (70% - 40%)6

Motif	Prediction	Source	DNA binding	Support	Actions
M05703_2.00	NN 70-40%	CisBP	ATTTTCCGTT	64.7% identity	Open · Scan
MA0624.1	NN 70-40%	JASPAR	ATTTTCCATT	52.5% identity	Open · Scan
MA1525.1	NN 70-40%	JASPAR	AATGGAAAAT	52.2% identity	Open · Scan
M02446_2.00	NN 70-40%	CisBP	ATTTTCCATT	52.0% identity	Open · Scan
M03449_2.00	NN 70-40%	CisBP	AGGGAAAATAATTTTCCATT	51.9% identity	Open · Scan
MA0152.1	NN 70-40%	JASPAR	TTTTCCA	51.3% identity	Open · Scan

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1060 aa

400-685

Residues: 286 aa
Domains: PF00554 · Rel homology DNA-binding domain PF16179 · Rel homology dimerisation domain
3D models: 1 active PDB
Templates: 2O93
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 400-6851 model

				Actions
Predicted = Low	DIMER_H3BRS1:400:685_2o93_L_1	2o93	400-685	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
418-576	PF00554	Rel homology DNA-binding domain	overlaps 400-685
587-684	PF16179	Rel homology dimerisation domain	overlaps 400-685